hs2st1a

Ensembl ID:
ENSDARG00000062078
ZFIN ID:
ZDB-GENE-070112-2312
Description:
heparan sulfate 2-O-sulfotransferase 1 [Source:RefSeq peptide;Acc:NP_001074139]
Human Orthologue:
HS2ST1
Human Description:
heparan sulfate 2-O-sulfotransferase 1 [Source:HGNC Symbol;Acc:5193]
Mouse Orthologue:
Hs2st1
Mouse Description:
heparan sulfate 2-O-sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1346049]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14728 Nonsense Available for shipment Available now
sa45098 Nonsense Mutation detected in F1 DNA During 2018
sa11765 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089327 Nonsense 176 354 4 7

The following transcripts of ENSDARG00000062078 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23156843)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22733071
GRCz11 2 22388722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGTTATCCGAGACCCCATTGAGCGTCTGGTGTCATACTATTATTTCCTG[C/T]GATTTGGAGATGATTACAGACCGGGYCTAMGACGCAGAAAACAAGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089327 Nonsense 271 354 6 7

The following transcripts of ENSDARG00000062078 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23154959)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22734955
GRCz11 2 22390606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAGGACTTCGTTATGATGCTGGAAGCGGCTCTTCCTCGCTTCTTT[A/T]AAGGGGCCACAGAACTCTATAAGACGGGTATGAATGCATAGACTATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089327 Essential Splice Site 279 354 6 7

The following transcripts of ENSDARG00000062078 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23154931)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22734983
GRCz11 2 22390634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGCTCTTCCTCGCTTCTTTAAAGGGGCCACAGAACTCTATAAGACGG[G/A]TATGAMTGCATAGACTNNGTGAATTNACATTTTAAWACTATATTTTCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link