
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hs2st1a
- Ensembl ID:
- ENSDARG00000062078
- ZFIN ID:
- ZDB-GENE-070112-2312
- Description:
- heparan sulfate 2-O-sulfotransferase 1 [Source:RefSeq peptide;Acc:NP_001074139]
- Human Orthologue:
- HS2ST1
- Human Description:
- heparan sulfate 2-O-sulfotransferase 1 [Source:HGNC Symbol;Acc:5193]
- Mouse Orthologue:
- Hs2st1
- Mouse Description:
- heparan sulfate 2-O-sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1346049]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14728 | Nonsense | Available for shipment | Available now |
sa45098 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11765 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14728
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089327 | Nonsense | 176 | 354 | 4 | 7 |
The following transcripts of ENSDARG00000062078 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 23156843)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 22733071 GRCz11 2 22388722 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- RTGTTATCCGAGACCCCATTGAGCGTCTGGTGTCATACTATTATTTCCTG[C/T]GATTTGGAGATGATTACAGACCGGGYCTAMGACGCAGAAAACAAGGAGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45098
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089327 | Nonsense | 271 | 354 | 6 | 7 |
The following transcripts of ENSDARG00000062078 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 23154959)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 22734955 GRCz11 2 22390606 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTGGAGGACTTCGTTATGATGCTGGAAGCGGCTCTTCCTCGCTTCTTT[A/T]AAGGGGCCACAGAACTCTATAAGACGGGTATGAATGCATAGACTATGTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11765
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089327 | Essential Splice Site | 279 | 354 | 6 | 7 |
The following transcripts of ENSDARG00000062078 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 23154931)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 22734983 GRCz11 2 22390634 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCGGCTCTTCCTCGCTTCTTTAAAGGGGCCACAGAACTCTATAAGACGG[G/A]TATGAMTGCATAGACTNNGTGAATTNACATTTTAAWACTATATTTTCTCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: