
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tab3
- Ensembl ID:
- ENSDARG00000062063
- ZFIN ID:
- ZDB-GENE-060503-408
- Description:
- TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 [Source:RefSeq peptide;Acc:NP_001038570]
- Human Orthologue:
- TAB3
- Human Description:
- TGF-beta activated kinase 1/MAP3K7 binding protein 3 [Source:HGNC Symbol;Acc:30681]
- Mouse Orthologue:
- Tab3
- Mouse Description:
- TGF-beta activated kinase 1/MAP3K7 binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1913974]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12767 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12767
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089274 | Essential Splice Site | None | 573 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 8 (position 19069706)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 18514594 GRCz11 8 18550306 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTCAGGCTTGATTTGAGTGTCTGACATGATGTTACTGGTGTGTGTTGTCA[G/T]GGGATGAGAGGAGAGCAGGTGCTGCGCTCCTGGCTGCGGACTCATTGACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: