si:dkeyp-106g6.1

Ensembl ID:
ENSDARG00000062058
ZFIN IDs:
ZDB-GENE-030829-61, ZDB-GENE-091113-16
Human Orthologue:
SLC12A7
Human Description:
solute carrier family 12 (potassium/chloride transporters), member 7 [Source:HGNC Symbol;Acc:10915]
Mouse Orthologue:
Slc12a7
Mouse Description:
solute carrier family 12, member 7 Gene [Source:MGI Symbol;Acc:MGI:1342283]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17478 Nonsense Available for shipment Available now
sa37961 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24565 Nonsense Available for shipment Available now
sa24564 Nonsense Available for shipment Available now
sa24563 Nonsense Available for shipment Available now
sa24562 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Nonsense 163 1119 5 26
ENSDART00000134251 Nonsense 141 1055 5 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41384282)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39923476
GRCz11 24 39811323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAGTAATTGTGTTTTATTGTGTTTTTGTTTTTTGTTCACAGACAATGT[T/A]GACCGCCATWTCAAKGAGTGCCATTGCCACAAACGGTGTTGTCCYAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Essential Splice Site 178 1119 5 26
ENSDART00000134251 Essential Splice Site 156 1055 5 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41384234)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39923428
GRCz11 24 39811275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGACCGCCATATCAATGAGTGCCATTGCCACAAACGGTGTTGTCCCAG[G/A]TAAGACACTTTCATATTAATTTACAACGTAAACGTGTGTGCATGTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Nonsense 336 1119 8 26
ENSDART00000134251 Nonsense 314 1055 8 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41381946)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39921140
GRCz11 24 39808987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGAAGACAGAAATAATCGACAACGTGACGGTGACCACCAAACTCTG[G/A]TCCCTGTTCTGCTCGGGGCCGGAGCTCAATGCCAGCTGTAATGAATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Nonsense 377 1119 9 26
ENSDART00000134251 Nonsense 355 1055 9 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41379761)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39918955
GRCz11 24 39806802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACACATCACTAATATTGAGCTGTTGTATGGTTTGCACAGAGAACATGT[G/A]GGGAAAGTACGGTCCGGCCGGGATGCTGGTGGAGAAAGATATACCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Nonsense 407 1119 9 26
ENSDART00000134251 Nonsense 385 1055 9 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41379670)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39918864
GRCz11 24 39806711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACCGTCTGTGTCTGCCAGTGATTCCTCGCAGGATAAATACATGCCGTA[T/A]GTGGTCAATGACATCACTGCCTTCTTCACGCTGCTGGTGGGAATCTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Essential Splice Site 864 1119 19 26
ENSDART00000134251 Essential Splice Site 842 1055 19 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41363233)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39902427
GRCz11 24 39790274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGAGGAATGCTGATGCTGCTGCCCTTCCTGCTGCGCCAGCACAAGG[T/G]CAGAAAACAACACAGCAATTTAATTTAATTTAATTTTATTTTATTTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link