si:ch211-236l14.3

Ensembl ID:
ENSDARG00000062054
ZFIN ID:
ZDB-GENE-030131-3250
Description:
Novel protein similar to vertebrate carnitine palmitoyltransferase 1A (Liver) (CPT1A) [Source:UniPro
Human Orthologue:
CPT1A
Human Description:
carnitine palmitoyltransferase 1A (liver) [Source:HGNC Symbol;Acc:2328]
Mouse Orthologue:
Cpt1a
Mouse Description:
carnitine palmitoyltransferase 1a, liver Gene [Source:MGI Symbol;Acc:MGI:1098296]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38079 Nonsense Mutation detected in F1 DNA During 2018
sa14518 Nonsense Available for shipment Available now
sa38080 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38081 Nonsense Mutation detected in F1 DNA During 2018
sa38082 Nonsense Mutation detected in F1 DNA During 2018
sa24683 Essential Splice Site Available for shipment Available now
sa25226 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089199 Nonsense 151 774 3 18
ENSDART00000137612   None 584 None 14
Genomic Location (Zv9):
Chromosome 25 (position 24326445)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23505558
GRCz11 25 23603106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGGATGTTTAACCAGCATGGAACTCTGTCCTTAAAAACAAAGATTTG[G/A]TTGGTAAGTGTGGAGAAACAGATAGATAATCCATCTCTTAATGTAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089199 Nonsense 166 774 4 18
ENSDART00000137612   None 584 None 14
Genomic Location (Zv9):
Chromosome 25 (position 24327289)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23506402
GRCz11 25 23603950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCTCAGGTGTTGGTGAAGTTATTTTCTGGGCCAAAGCCAATGCTGTA[C/A]AGCTTCCAGAGTTCACTACCACGGTTGCCAGTGCCTCCTGTAAAAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089199 Essential Splice Site 232 774 5 18
ENSDART00000137612 Essential Splice Site 46 584 1 14
Genomic Location (Zv9):
Chromosome 25 (position 24332536)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23511649
GRCz11 25 23609197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAACTTCAGTGGTACCTGAAGCTGAAATCCTGGTGGACTTCCAATTAC[G/A]TAAGATCACTCAATGTTTAATGTTTAATCGCATTGTCAAACTATTATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089199 Nonsense 239 774 6 18
ENSDART00000137612 Nonsense 53 584 2 14
Genomic Location (Zv9):
Chromosome 25 (position 24340290)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23519403
GRCz11 25 23616951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTTTAAATAAATTTGTTTCACACTTTCAGGTCAGCGACTGGTGGGAA[G/T]AGTACATTTACCTCAGAGGTCGAAGTCCAATCATGGTCAACAGCAATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089199 Nonsense 256 774 6 18
ENSDART00000137612 Nonsense 70 584 2 14
Genomic Location (Zv9):
Chromosome 25 (position 24340343)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23519456
GRCz11 25 23617004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATTTACCTCAGAGGTCGAAGTCCAATCATGGTCAACAGCAATTACTA[T/A]GCAATGGTAAGGCTGCTATGCACTCCATAAGCTCACTGACACGAAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089199 Essential Splice Site 626 774 15 18
ENSDART00000137612 Essential Splice Site 436 584 11 14
Genomic Location (Zv9):
Chromosome 25 (position 24359359)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23538472
GRCz11 25 23636020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCAAATTTCAGTAATCATTCTATTTCATGAATCTTTTTTTTTTCCTC[A/T]GAGAGAAGAGAGACTGAAGCTGCTGAAGGCGGCCACAGAAAAGCACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089199 Nonsense 643 774 15 18
ENSDART00000137612 Nonsense 453 584 11 14
Genomic Location (Zv9):
Chromosome 25 (position 24359413)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23538526
GRCz11 25 23636074
KASP Assay ID:
554-7594.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAGAGACTGAAGCTGCTGAAGGCGGCCACAGAAAAGCACCAGAATT[T/A]ATACAAACTGGCCATGACTGGAAAAGGCATTGACCGTCATCTTTTCTGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link