hmha1

Ensembl ID:
ENSDARG00000062049
ZFIN ID:
ZDB-GENE-071213-2
Description:
Hmha1 protein [Source:UniProtKB/TrEMBL;Acc:A4FVN1]
Human Orthologue:
HMHA1
Human Description:
histocompatibility (minor) HA-1 [Source:HGNC Symbol;Acc:17102]
Mouse Orthologue:
Hmha1
Mouse Description:
histocompatibility (minor) HA-1 Gene [Source:MGI Symbol;Acc:MGI:1917969]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45767 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24143 Nonsense Available for shipment Available now
sa37489 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089171 Essential Splice Site 214 1126 None 23
ENSDART00000132565   None 861 None 17

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17865688)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17616623
GRCz11 22 17641601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTGGAGACGCTCACCGCTGCTGGAAAACTCATCTCACAGGTCAAAGG[T/G]CAGAGCAAGGCACTTCTGGGTCTCGAAATTAAACACATTCTCAAACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089171 Nonsense 604 1126 14 23
ENSDART00000132565 Nonsense 339 861 8 17
Genomic Location (Zv9):
Chromosome 22 (position 17846512)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17597447
GRCz11 22 17622425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGCACCGACAGCGCTAATGCTGAAGCTCAGAGCAGTGCTGAGGTGCCA[C/T]AAACTGCAGGAGAGACTGGAGACACGAGCAGCTCACAGAAAGATGATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089171 Nonsense 895 1126 20 23
ENSDART00000132565 Nonsense 630 861 14 17
Genomic Location (Zv9):
Chromosome 22 (position 17841901)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17592836
GRCz11 22 17617814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTCCAGAGGGAGCTGACAGTGGTAAAGGACCAGACCTGATGGACCTT[G/T]GACCTGAGACGGATCCTGAACTCTTGGTCCTCGTGGACAGACTTAAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link