si:dkey-265o13.4

Ensembl ID:
ENSDARG00000062020
ZFIN ID:
ZDB-GENE-030131-9569
Description:
Genetic suppressor element 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LWL6]
Human Orthologues:
AC011317.1, KIAA0182
Human Description:
KIAA0182 [Source:HGNC Symbol;Acc:28979]
Mouse Orthologues:
Gm11027, Gse1
Mouse Descriptions:
genetic suppressor element 1 Gene [Source:MGI Symbol;Acc:MGI:1098275]
predicted gene 11027 Gene [Source:MGI Symbol;Acc:MGI:3779250]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36676 Nonsense Mutation detected in F1 DNA During 2018
sa36677 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23322 Essential Splice Site Available for shipment Available now
sa32211 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089150 Nonsense 283 1239 4 15
ENSDART00000140908 Nonsense 247 1203 4 15
Genomic Location (Zv9):
Chromosome 18 (position 30405094)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30482562
GRCz11 18 30460816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGATCCTGCCACTGCTGCAGCTGCTGCTGCCTACTACCACCCTGGATA[T/A]CTGCCTCATCCCTCCTTCTCTCACTACAGGTACACAAACACAAAACCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089150 Essential Splice Site 899 1239 10 15
ENSDART00000140908 Essential Splice Site 863 1203 10 15
Genomic Location (Zv9):
Chromosome 18 (position 30413487)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30490955
GRCz11 18 30469209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCACCATCTTCAGCCTCAACCACATCACACAGCAGCAGAGAAGAGG[T/C]ACTCATAGTGTGTAATATGTTCATAATTAGGGATGTCTTGCTTAGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089150 Essential Splice Site 936 1239 11 15
ENSDART00000140908 Essential Splice Site 900 1203 11 15
Genomic Location (Zv9):
Chromosome 18 (position 30414772)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30492240
GRCz11 18 30470494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACACAACCCTCACCCGCTTTGCAGAAGTCCTGCAGCCCATAGCTCAG[G/T]TTAGTTTGCATTGCTCTTCATCATGTGAATGCATGTACATTTGTTTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089150 Nonsense 1114 1239 13 15
ENSDART00000140908 Nonsense 1078 1203 13 15
Genomic Location (Zv9):
Chromosome 18 (position 30417758)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30495226
GRCz11 18 30473480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACCCACACCCTCCCTCATCTCAGCCCAACGGACAGCACTGCCCCCCA[C/T]AGCCCTCTCGTCAAGAGCTTTCTGCAGAGGAATCTGAGGAAGAAGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link