zgc:154063

Ensembl ID:
ENSDARG00000062002
ZFIN ID:
ZDB-GENE-061215-112
Description:
activity-dependent neuroprotector [Source:RefSeq peptide;Acc:NP_001073484]
Human Orthologue:
ADNP
Human Description:
activity-dependent neuroprotector homeobox [Source:HGNC Symbol;Acc:15766]
Mouse Orthologue:
Adnp
Mouse Description:
activity-dependent neuroprotective protein Gene [Source:MGI Symbol;Acc:MGI:1338758]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35089 Nonsense Mutation detected in F1 DNA During 2018
sa18289 Nonsense Available for shipment Available now
sa45430 Nonsense Mutation detected in F1 DNA During 2018
sa21912 Nonsense Available for shipment Available now
sa31831 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089120 Nonsense 137 969 4 4
Genomic Location (Zv9):
Chromosome 11 (position 26339323)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25168148
GRCz11 11 25405764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGAAACCCACGTCAGGCTCTTCCATATGCCTCACAATGTGATGCGT[C/T]AGGGTGTCGTTGGCCCTCATGGAGCTCCAGTAGGGGCTAAAGATGGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089120 Nonsense 388 969 4 4
Genomic Location (Zv9):
Chromosome 11 (position 26340077)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25168902
GRCz11 11 25406518
KASP Assay ID:
2260-4316.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCATGCTGCTACTGCCACATTGRCATCACTGCAGGCCAAGAAAGCTT[C/A]AGCCAATGCTCTGAAYACCTCACAAACACAAAAGTGGAAGATCTGTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089120 Nonsense 396 969 4 4
Genomic Location (Zv9):
Chromosome 11 (position 26340100)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25168925
GRCz11 11 25406541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATCACTGCAGGCCAAGAAAGCTTCAGCCAATGCTCTGAACACCTCA[C/T]AAACACAAAAGTGGAAGATCTGTACCATCTGCAATGAACTATTCCCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089120 Nonsense 557 969 4 4
Genomic Location (Zv9):
Chromosome 11 (position 26340583)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25169408
GRCz11 11 25407024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTCACAAAACAGCGCCATGCCCAAACCTGTGAAGGTGTCTGTAAGA[C/T]AGCCGGATACCCAAAGCGATTCATTGGTGCGAAACATGTCACAGTCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089120 Nonsense 570 969 4 4
Genomic Location (Zv9):
Chromosome 11 (position 26340623)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25169448
GRCz11 11 25407064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGTAAGACAGCCGGATACCCAAAGCGATTCATTGGTGCGAAACATGT[C/A]ACAGTCACCGGTGTCACAAAAGAAAGAGGTTGGAAAAACACTCTGCCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link