wdr74

Ensembl ID:
ENSDARG00000061993
ZFIN ID:
ZDB-GENE-060929-1138
Description:
WD repeat-containing protein 74 [Source:RefSeq peptide;Acc:NP_001070031]
Human Orthologue:
WDR74
Human Description:
WD repeat domain 74 [Source:HGNC Symbol;Acc:25529]
Mouse Orthologue:
Wdr74
Mouse Description:
WD repeat domain 74 Gene [Source:MGI Symbol;Acc:MGI:2147427]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30940 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089095 Nonsense 133 375 5 10
Genomic Location (Zv9):
Chromosome 10 (position 27690100)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 27092894
GRCz11 10 27054607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTCTTAGGTGGAGGTAAATGTTGGAAAGGACATTTGCAAAATGCGA[C/T]AGAACCAGTCACAGCGCCATCATGTGGCTACAGGGGGTAAAGAGAACCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link