zgc:153349

Ensembl ID:
ENSDARG00000061963
ZFIN ID:
ZDB-GENE-060929-700
Description:
Uncharacterized protein C14orf115 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08C99]
Human Orthologue:
VRTN
Human Description:
vertebrae development homolog (pig) [Source:HGNC Symbol;Acc:20223]
Mouse Orthologue:
7420416P09Rik
Mouse Description:
RIKEN cDNA 7420416P09 gene Gene [Source:MGI Symbol;Acc:MGI:3588197]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18682 Nonsense Available for shipment Available now
sa11680 Nonsense Available for shipment Available now
sa23724 Nonsense Available for shipment Available now
sa37050 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089013 Nonsense 281 677 2 2
ENSDART00000089013 Nonsense 281 677 2 2
Genomic Location (Zv9):
Chromosome 20 (position 27782250)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27853553
GRCz11 20 27752643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCTTCAAAATCAAGATACTCAGCTGTCTTACTCCAACCTCAAAAAC[A/T]AGTTCAACATCACCAAGAGCACCTTTTATCGCTGGAARAGGCAAAGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089013 Nonsense 281 677 2 2
ENSDART00000089013 Nonsense 281 677 2 2
Genomic Location (Zv9):
Chromosome 20 (position 27782250)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27853553
GRCz11 20 27752643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCTTCAAAATCAAGATACTCAGCTGTCTTACTCCAACCTCAAAAAC[A/T]AGTTCAACATCACCAAGAGCACCTTTTATCGCTGGAARAGGCAAAGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089013 Nonsense 506 677 2 2
Genomic Location (Zv9):
Chromosome 20 (position 27782927)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27854230
GRCz11 20 27753320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGAGTGAGGATCTCCAGACGCAAACACAGAAGCCTGAGGCTGGCGTA[C/G]CACCACAGGAAAATGTTAAGGGAAGAAGCCAAAATGCACATCCGAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089013 Nonsense 629 677 2 2
Genomic Location (Zv9):
Chromosome 20 (position 27783294)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27854597
GRCz11 20 27753687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACCATATGTTTGTGATGGATGTTGTGGCGCTGGCCAACTTCAAGGCC[A/T]AAGCAAAGCTGTTCTTGCAACAGCGCTTTGAAGAAAAGGCCTTTCCTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link