ube3b

Ensembl ID:
ENSDARG00000061960
ZFIN ID:
ZDB-GENE-060526-231
Description:
ubiquitin-protein ligase E3B [Source:RefSeq peptide;Acc:NP_001108154]
Human Orthologues:
HECTD3, UBE3B
Human Descriptions:
HECT domain containing 3 [Source:HGNC Symbol;Acc:26117]
ubiquitin protein ligase E3B [Source:HGNC Symbol;Acc:13478]
Mouse Orthologues:
Hectd3, Ube3b
Mouse Descriptions:
HECT domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1923858]
ubiquitin protein ligase E3B Gene [Source:MGI Symbol;Acc:MGI:1891295]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33564 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33565 Essential Splice Site Available for shipment Available now
sa25293 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20376 Essential Splice Site Available for shipment Available now
sa7558 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088968 Essential Splice Site 209 1069 6 25
Genomic Location (Zv9):
Chromosome 5 (position 21234951)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18947823
GRCz11 5 19451623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACATCATGGGACATCTAAATCAAAAGGGCTTCTACTCTGTTCTTCAGG[T/C]ACTGTTTATCCAGACAGCCAGTCTTATTTTTACCACAGAATAGGCATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088968 Essential Splice Site 429 1069 12 25
Genomic Location (Zv9):
Chromosome 5 (position 21242424)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18955296
GRCz11 5 19459096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTCCTGATTTCAATGAGGAACTTTTGTTGAACTCCCTGCACGATTA[G/T]ATCTGTTCAAGCGAGCATTCCAGAAATCTGCTTCTGTGCGGAACATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088968 Essential Splice Site 620 1069 15 25
Genomic Location (Zv9):
Chromosome 5 (position 21245024)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18957896
GRCz11 5 19461696
KASP Assay ID:
554-7606.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGGACTGTCGCAGGAGATTCACGCCTGAAGATCACTGGCTCCGCAA[G/A]TATGCCGCCCTCACATTATCACTGAGCCACATTACTCTGCTGATTTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088968 Essential Splice Site 835 1069 19 25
Genomic Location (Zv9):
Chromosome 5 (position 21248891)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18961763
GRCz11 5 19465563
KASP Assay ID:
2259-5608.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCCCTCGCTCGACTCCGAGTTTTACAAAAACCTCACCTCCATTAAGG[T/G]CAGTAATAATGCGACTACTACAAAGAAAGTTTGGGAAATGCTTGATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088968 Missense 916 1069 22 25
Genomic Location (Zv9):
Chromosome 5 (position 21251204)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18964076
GRCz11 5 19467876
KASP Assay ID:
554-4154.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTYATCAGGGGCTTTCGCAGCATCATCAAYCCAGAGTGGCTGCACATGT[T/G]TTCTACCCCGGAGGTCCAGAGGCKCATCTCGGGAGACAACGCTGARATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link