amotl2b

Ensembl ID:
ENSDARG00000061948
ZFIN ID:
ZDB-GENE-061103-307
Description:
angiomotin like 2b [Source:RefSeq peptide;Acc:NP_001071074]
Human Orthologue:
AMOTL2
Human Description:
angiomotin like 2 [Source:HGNC Symbol;Acc:17812]
Mouse Orthologue:
Amotl2
Mouse Description:
angiomotin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1929286]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32905 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088954 Nonsense 70 654 2 10
ENSDART00000145944 Nonsense 97 681 2 10
Genomic Location (Zv9):
Chromosome 2 (position 22310580)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23197285
GRCz11 2 22852936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCCTCAGCCAGGACGAGCCCCACTCTCCTCAGCTATCAACCCGCCAA[G/T]AACCGCAGGGTCAGGAGCACCAGGTGGACTACCAGCACTCGGAAAACTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link