
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-218h11.4
- Ensembl ID:
- ENSDARG00000061908
- ZFIN ID:
- ZDB-GENE-030131-4642
- Description:
- hypothetical protein LOC561964 [Source:RefSeq peptide;Acc:NP_001038437]
- Human Orthologue:
- C19orf28
- Human Description:
- chromosome 19 open reading frame 28 [Source:HGNC Symbol;Acc:28299]
- Mouse Orthologue:
- F630110N24Rik
- Mouse Description:
- RIKEN cDNA F630110N24 gene Gene [Source:MGI Symbol;Acc:MGI:3604804]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19739 | Nonsense | Available for shipment | Available now |
sa25108 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa11445 | Nonsense | Available for shipment | Available now |
sa8957 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa19739
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088867 | Nonsense | 276 | 489 | 5 | 10 |
ENSDART00000099702 | Nonsense | 276 | 506 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 2 (position 22546523)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 23433228 GRCz11 2 23088879 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTCAAATCTTCTCTAAACTCTGCTTTTTTATTCAGGTTGCACTGCTTTA[T/A]ATGTCCACCAGACTGATAGTAAACCTGTCACAAACATACATCTCCATGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25108
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088867 | Essential Splice Site | 390 | 489 | 7 | 10 |
ENSDART00000099702 | Essential Splice Site | 390 | 506 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 2 (position 22548631)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 23435336 GRCz11 2 23090987 - KASP Assay ID:
- 554-7415.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCTGGTCATGTCTCTTGCCATGACGGCTGAACTCATAGGAGACCAGACA[G/A]TAAGTATTGATCAAGCACATGCTATCAAACAAATGTTTTTCTGTGTGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11445
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088867 | None | 489 | None | 10 | |
ENSDART00000099702 | Nonsense | 469 | 506 | 10 | 11 |
ENSDART00000088867 | None | 489 | None | 10 | |
ENSDART00000099702 | Nonsense | 469 | 506 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 2 (position 22552714)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 23439419 GRCz11 2 23095070 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACTGATTCTCCTCATGGCTGACGTGTTGTTTTGTATTTCAGTATCTAAG[C/T]GAGGTCATATGAACGGTTCAATAAACGGCAATGGCTCAAAGGGTGAGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8957
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088867 | None | 489 | None | 10 | |
ENSDART00000099702 | Nonsense | 469 | 506 | 10 | 11 |
ENSDART00000088867 | None | 489 | None | 10 | |
ENSDART00000099702 | Nonsense | 469 | 506 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 2 (position 22552714)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 23439419 GRCz11 2 23095070 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACTGATTCTCCTCATGGCTGACGTGTTGTTTTGTATTTCAGTATCTAAG[C/T]GAGGTCATATGAACGGTTCAATAAACGGCAATGGCTCAAAGGGTGAGGGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: