v2ra18

Ensembl ID:
ENSDARG00000061903
ZFIN ID:
ZDB-GENE-050419-40
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQL4]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44891 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36683 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064137   None 252 None 1
ENSDART00000136603 Essential Splice Site 499 844 4 6
Genomic Location (Zv9):
Chromosome 18 (position 31553089)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33349948
GRCz11 18 33324543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAATTCAGCCTGAGCAGAGCTATCATTTGGTATGATGGCACTGAAGAG[G/A]TATTAAATGTGTTCTATAATAACTCCTGAATGTTATGGAATACTCTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064137   None 252 None 1
ENSDART00000136603 Essential Splice Site 541 844 6 6
Genomic Location (Zv9):
Chromosome 18 (position 31559272)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33356131
GRCz11 18 33330726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCTATTGTCCATGAATAACTTTTTAACACTGATTTCCTTACCTTCC[A/G]GATTGTTTGGATTGTCATGAATGTCTCTCAGACTACTGGCCCAATAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link