
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
v2rh10
- Ensembl ID:
- ENSDARG00000061883
- ZFIN ID:
- ZDB-GENE-050419-42
- Description:
- Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQH7]
- Mouse Orthologues:
- AC139131.1, AC161211.1, AC161211.2, Vmn2r54
- Mouse Descriptions:
- vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
- vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
- vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
- vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2967 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2967
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088786 | Nonsense | 312 | 842 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 31651013)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 33447872 GRCz11 18 33422467 - KASP Assay ID:
- 554-3021.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACACWCCACGTTTCCTGCCCTTCCTTGGGGGCACACTTGGCATAGCCATC[A/T]GACGTGGAGAGATTGAGGGGCTCCGTGAATTTCTTTTACAGCTTCGTCCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: