v2rx3

Ensembl ID:
ENSDARG00000061873
ZFIN ID:
ZDB-GENE-050419-262
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQL8]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43134 Nonsense Mutation detected in F1 DNA During 2018
sa18387 Nonsense Available for shipment Available now
sa18204 Nonsense Available for shipment Available now
sa29060 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078381 Nonsense 403 853 3 6
ENSDART00000137208 Nonsense 337 813 2 5
Genomic Location (Zv9):
Chromosome 18 (position 31506391)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33303250
GRCz11 18 33277845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGCAGTATTCTGCCTATTTAAACACATCCAGTCCTCGCATTTCCTA[T/A]AATGTCTACAAAGCAGCATATGCCATTGCATATTCCCTGCACAATCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078381 Nonsense 612 853 6 6
ENSDART00000137208 Nonsense 572 813 5 5
Genomic Location (Zv9):
Chromosome 18 (position 31509084)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33305943
GRCz11 18 33280538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTAGCAGGAGCCTGCCTCACATTAGCTGTGTTTTCCKTGTTTCTTTA[T/A]TACAAAAACACTCCTGTAGTACGCATAAATAACTCCGAACTCAGTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078381 Nonsense 676 853 6 6
ENSDART00000137208 Nonsense 636 813 5 5
Genomic Location (Zv9):
Chromosome 18 (position 31509275)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33306134
GRCz11 18 33280729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WTTCAGCATCACCTTCTCGCTTTGCATYTCYTGCATCTTGGGAAAGACTT[T/A]AGTGGTGCTGGCTGCTTTCACAGCGACCCGACCTGGAAACAATWTAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078381 Nonsense 694 853 6 6
ENSDART00000137208 Nonsense 654 813 5 5
Genomic Location (Zv9):
Chromosome 18 (position 31509330)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33306189
GRCz11 18 33280784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGGCTGCTTTCACAGCGACCCGACCTGGAAACAATTTAATGAAATG[G/A]TTGGGCCCTACACAGCAGAGAATCATCATTTTCTGCTGCACTCTCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link