wu:fa07b03

Ensembl ID:
ENSDARG00000061864
ZFIN IDs:
ZDB-GENE-030131-6822, ZDB-GENE-030131-6822
Description:
Wu:fa07b03 protein [Source:UniProtKB/TrEMBL;Acc:Q0P3X3]
Human Orthologue:
HDLBP
Human Description:
high density lipoprotein binding protein [Source:HGNC Symbol;Acc:4857]
Mouse Orthologues:
4921511C20Rik, Gm382, Hdlbp
Mouse Descriptions:
high density lipoprotein (HDL) binding protein Gene [Source:MGI Symbol;Acc:MGI:99256]
predicted gene 382 Gene [Source:MGI Symbol;Acc:MGI:2685228]
RIKEN cDNA 4921511C20 gene Gene [Source:MGI Symbol;Acc:MGI:2685229]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22089 Nonsense Available for shipment Available now
sa42024 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35286 Nonsense Available for shipment Available now
sa44761 Nonsense Mutation detected in F1 DNA During 2018
sa35287 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039725   None 290 None 8
ENSDART00000128279 Nonsense 374 1259 7 26
ENSDART00000128454   None 292 None 8
Genomic Location (Zv9):
Chromosome 12 (position 23771736)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22294898
GRCz11 12 22416117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTAAAAGTGTTATAGTGGCAGAAGTGATTGCTCCGGCTTGGCTTCAT[C/T]GATTCATCATTGGCAAGAAAGGACAAAACATCAGTCGCATTACACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039725   None 290 None 8
ENSDART00000128279 Essential Splice Site 574 1259 12 26
ENSDART00000128454   None 292 None 8
Genomic Location (Zv9):
Chromosome 12 (position 23782383)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22305545
GRCz11 12 22426764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGTGGAGAAATGTGCAAAGTTTCTGCAGAAACTCATCGCTGAGCTGG[T/C]ACTAGAGTAATTTCCTCTTGCTTCCTTCCTCCTCTCAAATAACGTTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039725   None 290 None 8
ENSDART00000128279 Nonsense 951 1259 19 26
ENSDART00000128454   None 292 None 8
Genomic Location (Zv9):
Chromosome 12 (position 23790838)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22314000
GRCz11 12 22435219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACTGTGACGGGACGAGCTGAAAAGTGTGAATTGGCACGGGCTGCTT[T/A]ACTTGTAAGACAATATCTCAATTCTAGCTCTCGCTTTTGTGTTGTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039725   None 290 None 8
ENSDART00000128279 Nonsense 1013 1259 21 26
ENSDART00000128454   None 292 None 8
Genomic Location (Zv9):
Chromosome 12 (position 23792723)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22315885
GRCz11 12 22437104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAGTCAGACATCATAAAGATCACAGGACAGGTGGCCAGTGTGGAG[C/T]GAGCCAAACACGGGCTGCTGGACAGAGTCAAAGAGCTGCAGGCCGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039725   None 290 None 8
ENSDART00000128279 Essential Splice Site 1080 1259 22 26
ENSDART00000128454   None 292 None 8
Genomic Location (Zv9):
Chromosome 12 (position 23794594)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22317756
GRCz11 12 22438975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGTACGATGTAAACGTTCAGTTCCCGGACAAGGGTGATGAGCAGCAG[G/A]TATGTATTAACCACAGAGCACATTTCCTCGTGCTTGAGCACAGACCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link