
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000061850
- Ensembl ID:
- ENSDARG00000061850
- Human Orthologue:
- CAPN5
- Human Description:
- calpain 5 [Source:HGNC Symbol;Acc:1482]
- Mouse Orthologue:
- Capn5
- Mouse Description:
- calpain 5 Gene [Source:MGI Symbol;Acc:MGI:1100859]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6077 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34042 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34043 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa20907 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6077
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088686 | Nonsense | 52 | 641 | 1 | 13 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21633537)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 20223973 GRCz11 7 20475941 - KASP Assay ID:
- 554-3723.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGCCGAGTCGCTCTTCTACAGAAGGACGCCCCCTCCAGGACTGACATGG[A/T]AGAGACCCAGCGTATGAGTATCCTTTTTTGATTGTGCAAGTGCTAANNNNTAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34042
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088686 | Nonsense | 245 | 641 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21635270)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 20225706 GRCz11 7 20477674 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTTTTTGTGTGTTACAGCCAGCAGAAGGGGAGGCTTTAGAATCAGTTT[T/A]GGACTGTGGACTAATAAAAGGTCATGCATATGGTGTGACTGCTGTCAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34043
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088686 | Essential Splice Site | 495 | 641 | 10 | 13 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21657675)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 20248111 GRCz11 7 20500079 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCCTGGTGCTACTGGGCGGTTCCTTCTGCGTTTTTTCTCACACTCACAT[G/A]TGCGCCTCAGGTAGAGACAAGAGAATTGGCCCTTTGCTAGCTCTGCTCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20907
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088686 | Essential Splice Site | 585 | 641 | 12 | 13 |
- Genomic Location (Zv9):
- Chromosome 7 (position 21659587)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 20250023 GRCz11 7 20501991 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAAGCGATTTTTTACAGCAGGAAGCTGAAGTCAAAAATCTCCATTGAGG[T/G]CAGAAGCTAAACCACACTGTATTTTGATCATGTTTTATCATTGGCATATA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cognitive performance: A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: