
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
im:7158374
- Ensembl ID:
- ENSDARG00000061844
- ZFIN ID:
- ZDB-GENE-060810-103
- Human Orthologue:
- ARHGEF15
- Human Description:
- Rho guanine nucleotide exchange factor (GEF) 15 [Source:HGNC Symbol;Acc:15590]
- Mouse Orthologue:
- Arhgef15
- Mouse Description:
- Rho guanine nucleotide exchange factor (GEF) 15 Gene [Source:MGI Symbol;Acc:MGI:3045246]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35285 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa6251 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22088 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35285
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088470 | Essential Splice Site | 766 | 937 | 11 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23722629)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22245791 GRCz11 12 22367010 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTACCTCTTTCTTTTCAATGACCTACTTGTCATTGCCATCAAGAAAAG[G/A]TAAAATGCTGGAAAAACCTGTCTGTGTTATGCTTCACTTTGTTTCTTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6251
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088470 | Nonsense | 809 | 937 | 12 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23721475)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22244637 GRCz11 12 22365856 - KASP Assay ID:
- 554-4547.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCAACATAGAGCACTGCTTCTGTCTGACGCTGCTGGAGAATCACCAGGGA[C/T]GACAGATGGAGAGAATCATGAAGGCTCCCTCACAGTGCGTGAAGTTATAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22088
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088470 | Nonsense | 854 | 937 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23719633)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22242795 GRCz11 12 22364014 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGTTGCTCTTGAATCACATGTGGTTTTGTATGTCAGATTGTCCTCAGGTG[C/T]AGTGTGTGGAGCAGTATGTGGCAAAACAATCGGATGAATTAAATCTGGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: