zgc:136878

Ensembl ID:
ENSDARG00000061836
ZFIN ID:
ZDB-GENE-060421-5000
Description:
hypothetical protein LOC678521 [Source:RefSeq peptide;Acc:NP_001035338]
Human Orthologue:
NFIX
Human Description:
nuclear factor I/X (CCAAT-binding transcription factor) [Source:HGNC Symbol;Acc:7788]
Mouse Orthologue:
Nfix
Mouse Description:
nuclear factor I/X Gene [Source:MGI Symbol;Acc:MGI:97311]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10966 Nonsense Available for shipment Available now
sa40016 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018
sa10725 Essential Splice Site Available for shipment Available now
sa26010 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044670 Nonsense 79 556 3 14
ENSDART00000090235 Nonsense 79 440 3 11
ENSDART00000122994 Nonsense 53 414 2 10
ENSDART00000139001 Nonsense 123 485 3 11
Genomic Location (Zv9):
Chromosome 3 (position 14464540)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14710047
GRCz11 3 14859847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGCACGAGAAGCGCATGACGAAGGATGAGGAGCRCGCCGTCAAAGAC[G/T]AACTCCTGGGCGAGAAGCCCGAGATCAAGCAGAAGTGGGCGTCCCGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044670 Splice Site None 556 None 14
ENSDART00000090235 Splice Site None 440 None 11
ENSDART00000122994 Splice Site None 414 None 10
ENSDART00000139001 Essential Splice Site 251 485 4 11
Genomic Location (Zv9):
Chromosome 3 (position 14611412)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14856919
GRCz11 3 15006719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTATGTTTAATCTGCTCTCTTTCTCTCTCTCTTTTTCCTCTCGGCTC[T/A]GCAGAATCTGGACAATCGGATAACTCCAACCAGCAAGGAGAAGCAGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044670 Essential Splice Site 290 556 6 14
ENSDART00000090235 Essential Splice Site 290 440 6 11
ENSDART00000122994 Essential Splice Site 264 414 5 10
ENSDART00000139001 Essential Splice Site 335 485 6 11
Genomic Location (Zv9):
Chromosome 3 (position 14619734)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14865241
GRCz11 3 15015041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACATTAACCTGGGTCGCCGCTCCATTAYGTCCACGCCATCWACCAGG[T/C]ACACACAAYATCACACACYYTTTTCATTCTGAGCGCCAAGTGCATTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044670 Essential Splice Site 553 556 14 14
ENSDART00000090235 Essential Splice Site None 440 11 11
ENSDART00000122994 Essential Splice Site None 414 10 10
ENSDART00000139001 Essential Splice Site None 485 11 11
Genomic Location (Zv9):
Chromosome 3 (position 14661750)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14907257
GRCz11 3 15057057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATATAGTAAAACACTAACAATGCCTTTATATTATGTGTTTTTTTTACA[G/A]TCATGGTTCCTTTGACGAGGTCCTGCCTGCAACCTGTCGACACAATTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link