ZPLD1 (1 of 2)

Ensembl ID:
ENSDARG00000061835
Description:
zona pellucida-like domain containing 1 [Source:HGNC Symbol;Acc:27022]
Human Orthologue:
ZPLD1
Human Description:
zona pellucida-like domain containing 1 [Source:HGNC Symbol;Acc:27022]
Mouse Orthologue:
Zpld1
Mouse Description:
zona pellucida like domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2443415]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa546 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa546
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088654 Essential Splice Site 312 412 8 10
Genomic Location (Zv9):
Chromosome 10 (position 29855572)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29228016
GRCz11 10 29114641
KASP Assay ID:
554-0456.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTAAACTCAGGTCTGTGTTTATTTGTTACAAATATTGTCTTCCTGAC[A/C]GATCTGCGGTAAGAGGAAGAAAAGGGATGTGTCAGAAAGAAGCGGTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link