SNTG1

Ensembl ID:
ENSDARG00000061832
Description:
syntrophin, gamma 1 [Source:HGNC Symbol;Acc:13740]
Human Orthologue:
SNTG1
Human Description:
syntrophin, gamma 1 [Source:HGNC Symbol;Acc:13740]
Mouse Orthologue:
Sntg1
Mouse Description:
syntrophin, gamma 1 Gene [Source:MGI Symbol;Acc:MGI:1918346]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44174 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24538 Nonsense Available for shipment Available now
sa32494 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088609 Essential Splice Site 55 526 3 17
Genomic Location (Zv9):
Chromosome 24 (position 36772222)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35391032
GRCz11 24 35277529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGAGACTCTGTGGCATGAAAGTGACGCGTTTGCTTTGATTGTGTGC[A/G]GGAAAGAACAGTAACGATCCGTCGGCAGACAATCGGAGGGTTTGGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088609 Nonsense 218 526 9 17
Genomic Location (Zv9):
Chromosome 24 (position 36764808)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35383934
GRCz11 24 35270431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGATGGGTGGATCTGCGCCTTATCCCGCTCTTACATGCTCGCCTGTCC[C/T]AGTACGTCCCAGGTACTGACATTTGCAGGTGAGCTGAGCATATGGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088609 Nonsense 240 526 10 17
Genomic Location (Zv9):
Chromosome 24 (position 36764310)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35383436
GRCz11 24 35269933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCATCAGGCAAAACGCCTTTCAAGTCATCGCGGTGGACGGAGTGTG[C/A]AGCGGGGTAATTCAGTGTCCCGGTACTGACGAATGCACCGATTGGCTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link