si:dkey-110c1.7

Ensembl ID:
ENSDARG00000061829
ZFIN ID:
ZDB-GENE-050208-748
Description:
protein unc-13 homolog A [Source:RefSeq peptide;Acc:NP_001038630]
Human Orthologue:
UNC13A
Human Description:
unc-13 homolog A (C. elegans) [Source:HGNC Symbol;Acc:23150]
Mouse Orthologue:
Unc13a
Mouse Description:
unc-13 homolog A (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3051532]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24154 Essential Splice Site, Splice Site Available for shipment Available now
sa43815 Nonsense Mutation detected in F1 DNA During 2018
sa43816 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43817 Nonsense Mutation detected in F1 DNA During 2018
sa43818 Nonsense Mutation detected in F1 DNA During 2018
sa45771 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17084 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088603 Essential Splice Site 24 1742 1 40
ENSDART00000135692 Splice Site None 528 None 10
ENSDART00000142748   None 1178 None 28
Genomic Location (Zv9):
Chromosome 22 (position 20513680)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20170373
GRCz11 22 20195351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGTCTCTCTTTTACAGTGAAGAAAGCCAAGCTCGATGGACCACAAGG[T/C]AAGCCTGACATCTCACTGTAACTGATTTTCCACACATAACTTAAATATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088603 Nonsense 45 1742 2 40
ENSDART00000135692 Nonsense 38 528 2 10
ENSDART00000142748   None 1178 None 28
Genomic Location (Zv9):
Chromosome 22 (position 20513840)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20170533
GRCz11 22 20195511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACGTGTCACTGAAGGTTCAAAATGTGAAAAGCACCACCATAGCTGTG[C/T]GAGGCAGTCAGCCATGTTGGGAACAGGACTTCATGTTGTGAGTTCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088603 Essential Splice Site 255 1742 8 40
ENSDART00000135692 Essential Splice Site 248 528 8 10
ENSDART00000142748   None 1178 None 28
Genomic Location (Zv9):
Chromosome 22 (position 20517436)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20174129
GRCz11 22 20199107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACAACGAAATGCACGACTACGACTATGATAACCAGAGGGCAATTAGG[T/C]ATATTATCCCAATTTTTAAGTGTGGAGTAGTGTCTAATGCTAGCCACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088603 Nonsense 650 1742 14 40
ENSDART00000135692   None 528 None 10
ENSDART00000142748 Nonsense 86 1178 2 28
Genomic Location (Zv9):
Chromosome 22 (position 20526862)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20183555
GRCz11 22 20208533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCGCTCGACAGGGCATGCGCTGCACAGAATGTGGGGTCAAGTGCCAC[G/T]AGAAGTGTCAAGATTTACTCAATGCCGATTGCCTGCAGAGTAAGAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088603 Nonsense 1081 1742 23 40
ENSDART00000135692   None 528 None 10
ENSDART00000142748 Nonsense 517 1178 11 28
Genomic Location (Zv9):
Chromosome 22 (position 20533071)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20189764
GRCz11 22 20214742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTACGAATATATTTTCAACAACTGCCACGAGCTCTACAGCCGAGAATA[C/A]CAAACAGACCCAGTGAGTCGATGCACCCCGATCAATCCCAAAAAAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088603 Essential Splice Site 1201 1742 27 40
ENSDART00000135692   None 528 None 10
ENSDART00000142748 Essential Splice Site 637 1178 15 28
Genomic Location (Zv9):
Chromosome 22 (position 20536738)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20193431
GRCz11 22 20218409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGCAATGATGGGTAATAATGGAGCTTTGGTTGGTGATATTGCTTTGC[A/T]GGTGGTTTGAGCCGTTTGTCATTCAGTGGTTGGATGAGAATGAGGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088603 Nonsense 1470 1742 35 40
ENSDART00000135692   None 528 None 10
ENSDART00000142748 Nonsense 906 1178 23 28
Genomic Location (Zv9):
Chromosome 22 (position 20548362)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20205055
GRCz11 22 20230033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGTTTCTCGCTTTTCCGTTTTGCTTTCCATCTTCCTTCAGGGCACT[C/T]AACTCATATTYAACGCAGCCAAGGAACTCGGTCAGCTTTCCAAGCTTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link