zbtb4

Ensembl ID:
ENSDARG00000061827
ZFIN ID:
ZDB-GENE-100318-5
Description:
KAISO-like zinc finger protein [Source:UniProtKB/TrEMBL;Acc:Q06Z31]
Human Orthologue:
ZBTB4
Human Description:
zinc finger and BTB domain containing 4 [Source:HGNC Symbol;Acc:23847]
Mouse Orthologue:
Zbtb4
Mouse Description:
zinc finger and BTB domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1922830]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12821 Nonsense Available for shipment Available now
sa12483 Nonsense Available for shipment Available now
sa1477 Nonsense Available for shipment Available now
sa35289 Nonsense Mutation detected in F1 DNA During 2018
sa44762 Nonsense Mutation detected in F1 DNA During 2018
sa22094 Nonsense Available for shipment Available now
sa35288 Nonsense Mutation detected in F1 DNA During 2018
sa17032 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073962 Nonsense 122 1529 1 2
ENSDART00000088650 Nonsense 122 913 2 2
Genomic Location (Zv9):
Chromosome 12 (position 23892470)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22415620
GRCz11 12 22536839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAGAACTGCAAGTCATCTCTGTCAGTTTCTGTTGATGGTAGTGRTTCC[A/T]GATACCCMGCATCTCCTTTACAAYACTCTAATAAAATGGACAGTCCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073962 Nonsense 403 1529 1 2
ENSDART00000088650 Nonsense 403 913 2 2
Genomic Location (Zv9):
Chromosome 12 (position 23891625)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22414775
GRCz11 12 22535994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCCAGCCTGMAGCGACACTCCARTGTGCATTCCTGGCGCCGGAAGTA[C/A]CCCTGTCACTTCTGTGACAAGGTTTTTGCTCTGGCTGAATATCGTACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073962 Nonsense 628 1529 1 2
ENSDART00000088650 Nonsense 628 913 2 2
Genomic Location (Zv9):
Chromosome 12 (position 23890952)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22414102
GRCz11 12 22535321
KASP Assay ID:
554-1402.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAGTCATCATGCACAGCACTGCAGTTTCTTCCTCTGTCATTGTTCAC[A/T]GAAATAAGACAGACTCTGAAGAGAGAAAAAGAAGTCCAGAAAAGCATCAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073962 Nonsense 701 1529 1 2
ENSDART00000088650 Nonsense 701 913 2 2
Genomic Location (Zv9):
Chromosome 12 (position 23890733)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22413895
GRCz11 12 22535114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGAAACTTCACAAGGGACGAAAAGTTCACCATAAAACAGACTCAAGT[A/T]AAACAATACCTTTAGCGGTGGGATCAGAAGTCAAAGGGAGTGGTCCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073962 Nonsense 1034 1529 2 2
ENSDART00000088650   None 913 None 2
Genomic Location (Zv9):
Chromosome 12 (position 23889599)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22412761
GRCz11 12 22533980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTGATAAGGTCTGCAAAACCTCTGCTGCACTTAACTGCCACCTCAAG[C/T]GACATGAGTTAGGGAGTTTAACAGAGGTTGAAGATGCACATGAAAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073962 Nonsense 1184 1529 2 2
ENSDART00000088650   None 913 None 2
Genomic Location (Zv9):
Chromosome 12 (position 23889149)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22412311
GRCz11 12 22533530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAGAAAAACTAGATCAGCAGAAAAGAAGCCAGACACCAAGTAACAGA[C/T]AAATCCAAGTTTCTCAAATGCTGACAGAGCCTCAGATTAGAAGAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073962 Nonsense 1400 1529 2 2
ENSDART00000088650   None 913 None 2
Genomic Location (Zv9):
Chromosome 12 (position 23888499)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22411661
GRCz11 12 22532880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTACTCATACAGAACACCACAGGGTCTCGGGCTACCCTGTGCAGGAGTA[T/A]TCTCTTCCAATGGTTATTCCTGGAGGGTACTGTTCTGGTAAGAATCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073962 Nonsense 1445 1529 2 2
ENSDART00000088650   None 913 None 2
Genomic Location (Zv9):
Chromosome 12 (position 23888366)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22411528
GRCz11 12 22532747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTRCCATTTCCTCCACTTGGGAAAATGGTACCCCATGCTGACTCCACT[A/T]AACTGCCCTTTTACCCCGACCCTTATCACCTACTGTRTGGCCCACAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link