wscd2

Ensembl ID:
ENSDARG00000061819
ZFIN ID:
ZDB-GENE-060526-124
Description:
WSC domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A2BGL3]
Human Orthologue:
WSCD2
Human Description:
WSC domain containing 2 [Source:HGNC Symbol;Acc:29117]
Mouse Orthologue:
Wscd2
Mouse Description:
WSC domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2445030]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18797 Nonsense Mutation detected in F1 DNA During 2018
sa9102 Nonsense Mutation detected in F1 DNA During 2018
sa20380 Nonsense Available for shipment Available now
sa40395 Nonsense Mutation detected in F1 DNA During 2018
sa1167 Nonsense Confirmed mutation in F2 line During 2018
sa25294 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088639 Nonsense 11 572 1 8
ENSDART00000088639 Nonsense 11 572 1 8
Genomic Location (Zv9):
Chromosome 5 (position 22461596)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20174468
GRCz11 5 20678268
KASP Assay ID:
2259-5650.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCTCGAGAGCCCATCATGGCCAGATCTCTGCTGAAGATCCACCGCTA[T/A]TTTCGGCGTAAACCGGTGCGCTTTTTCTCCTTCATCCTGCTCTACCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088639 Nonsense 11 572 1 8
ENSDART00000088639 Nonsense 11 572 1 8
Genomic Location (Zv9):
Chromosome 5 (position 22461596)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20174468
GRCz11 5 20678268
KASP Assay ID:
2259-5650.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCTCGAGAGCCCATCATGGCCAGATCTCTGCTGAAGATCCACCGCTA[T/A]TTTCGGCGTAAACCGGTGCGCTTTTTCTCCTTCATCCTGCTCTACCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088639 Nonsense 110 572 1 8
Genomic Location (Zv9):
Chromosome 5 (position 22461301)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20174173
GRCz11 5 20677973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCGTGGATGAAGGAGAGTAGGGGGCAGGATGCACCCGAGTGGGCCGGA[C/T]GAGGATTTGATCACACCAGCAGCTGGAGCCATGGAGCCAAAGGACGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088639 Nonsense 177 572 3 8
Genomic Location (Zv9):
Chromosome 5 (position 22430870)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20143742
GRCz11 5 20647542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAATGAATGATGATGTTGTTTTCTCTGTGTTTCAGGGGTTATCTTTA[T/A]GCTGGTCTCGAGTTTGGAGCCGAGTGCTACTGTGGCCATAAGATCCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1167
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088639 Nonsense 358 572 6 8
Genomic Location (Zv9):
Chromosome 5 (position 22417586)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20130458
GRCz11 5 20634258
KASP Assay ID:
554-1077.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTTTACCTACTCGTTCCAAGCACCTAATGGCACTAGCTAGTTTTCCC[G/T]GAGCGGGCAACACCTGGGCCCGTCACCTTATTGAGCTGGCCACRGGTTAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088639 Nonsense 386 572 6 8
Genomic Location (Zv9):
Chromosome 5 (position 22417500)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20130372
GRCz11 5 20634172
KASP Assay ID:
554-7774.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCCACGGGTTACTACACCGGCAGTTACTATTTTGATGGCTCACTCTA[C/A]AACAAAGGTCAACTACTCAAAAACTTTTTGGTTTTCTCAAAAGCCATCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link