zgc:162316

Ensembl ID:
ENSDARG00000061802
ZFIN ID:
ZDB-GENE-070410-70
Description:
CCR4-NOT transcription complex subunit 2 [Source:RefSeq peptide;Acc:NP_001082993]
Human Orthologue:
CNOT2
Human Description:
CCR4-NOT transcription complex, subunit 2 [Source:HGNC Symbol;Acc:7878]
Mouse Orthologue:
Cnot2
Mouse Description:
CCR4-NOT transcription complex, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1919318]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38099 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44329 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088383   None 520 None 15
ENSDART00000134072   None 110 1 4
ENSDART00000139965 Essential Splice Site None 174 None 6
ENSDART00000148366   None 188 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29546537)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28236631
GRCz11 25 28679833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGCACTTTAAAGCGGCTTATATAGCCTTGGGTCTTGTTCTGCAGTGG[T/A]AATTCATTATTTATTACTAGTTCTCAGTGTTGCTGTGTAGAAGAACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088383 Essential Splice Site 197 520 6 15
ENSDART00000134072   None 110 None 4
ENSDART00000139965   None 174 None 6
ENSDART00000148366   None 188 None 4
Genomic Location (Zv9):
Chromosome 25 (position 29560050)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28250144
GRCz11 25 28693346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGGTTTGGAATGAACTCCTTATCCAATAACATCTTCAACGGGACAGG[T/C]GAGTGATGTTCATGACAGGAAACACGAGTGTGTTTTAGAAAGAGGAAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link