zgc:153175

Ensembl ID:
ENSDARG00000061773
ZFIN ID:
ZDB-GENE-060929-1210
Description:
hypothetical protein LOC767739 [Source:RefSeq peptide;Acc:NP_001070176]
Human Orthologue:
NEURL
Human Description:
neuralized homolog (Drosophila) [Source:HGNC Symbol;Acc:7761]
Mouse Orthologue:
Neurl1a
Mouse Description:
neuralized homolog 1A (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1334263]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1120 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088490 Essential Splice Site 57 498 2 6
Genomic Location (Zv9):
Chromosome 17 (position 20334534)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20484545
GRCz11 17 20504381
KASP Assay ID:
554-1021.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTTCACCAGCCGCCCAGTTGGGGTCTACGAGCAGGTCCGGCTGAAGG[T/C]ATGGTAACCCAACGCTCACCCGTTTCCACATGCCATCCTGTAAAAGCGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link