zgc:153503

Ensembl ID:
ENSDARG00000061770
ZFIN ID:
ZDB-GENE-060929-396
Description:
ATP-binding cassette sub-family D member 4 [Source:RefSeq peptide;Acc:NP_001070185]
Human Orthologue:
ABCD4
Human Description:
ATP-binding cassette, sub-family D (ALD), member 4 [Source:HGNC Symbol;Acc:68]
Mouse Orthologue:
Abcd4
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 4 Gene [Source:MGI Symbol;Acc:MGI:1349217]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37941 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088480 Nonsense 109 277 4 8
ENSDART00000129679 Nonsense 109 604 4 19
Genomic Location (Zv9):
Chromosome 24 (position 37414874)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36030300
GRCz11 24 35918397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTGAAGAGTCTGGACCAGTATATCTGCAGTTTGCTGTATGTCAGATG[G/A]AGAAAGACTTTAACTGAAGATCTCCATCACCTATACTTCAAGGGACGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link