zgc:153294

Ensembl ID:
ENSDARG00000061763
ZFIN ID:
ZDB-GENE-060929-204
Description:
spermatogenesis associated 5-like 1 [Source:RefSeq peptide;Acc:NP_001070056]
Human Orthologue:
SPATA5L1
Human Description:
spermatogenesis associated 5-like 1 [Source:HGNC Symbol;Acc:28762]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28964 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101660 Nonsense 612 748 6 9
ENSDART00000129459 Nonsense 612 748 7 10
Genomic Location (Zv9):
Chromosome 18 (position 4906767)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5680279
GRCz11 18 5533141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCTGCAGAAAGATTGCTCTGTTAGAAGGTGGAGATCAGGAGGACGTA[C/T]GACTACATCAGGTCAGAGTCGAGGATTATGCATATGTTTATTGTATTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link