itpr3
- Ensembl ID:
- ENSDARG00000061741
- ZFIN ID:
- ZDB-GENE-070605-1
- Description:
- inositol 1,4,5-triphosphate receptor, type 3 [Source:RefSeq peptide;Acc:NP_001121741]
- Human Orthologue:
- ITPR3
- Human Description:
- inositol 1,4,5-triphosphate receptor, type 3 [Source:HGNC Symbol;Acc:6182]
- Mouse Orthologue:
- Itpr3
- Mouse Description:
- inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI Symbol;Acc:MGI:96624]
Alleles
There are 15 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa41183 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa11400 |
Nonsense |
Available for shipment |
Available now |
sa17468 |
Nonsense |
Available for shipment |
Available now |
sa41184 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa21271 |
Essential Splice Site |
Available for shipment |
Available now |
sa21272 |
Essential Splice Site |
Available for shipment |
Available now |
sa21273 |
Nonsense |
Available for shipment |
Available now |
sa14415 |
Nonsense |
Available for shipment |
Available now |
sa21274 |
Splice Site, Nonsense |
Available for shipment |
Available now |
sa13385 |
Nonsense |
Available for shipment |
Available now |
sa41185 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa45319 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa41186 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa21275 |
Essential Splice Site |
Available for shipment |
Available now |
sa15369 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa41183
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 21822788)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21252685 |
GRCz11 |
8 |
21284770 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATTGATTTGTTTATTCTTCTCCTACAAAAGCATGCAGCTAATTTGGAA[C/T]AAAAGCAGAATGATGCTGAGAACAAAAAGGTCCACGGCGATGTGGTTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11400
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 21829893)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21259790 |
GRCz11 |
8 |
21291875 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTGATCCTGAATCCTGTGAATGCTGGACAGCCTCTCCATGCCAGCAGCTA[T/A]GAGCTTCCCGATCAYTCAGGGTGCAAAGAGGTTTGCGATRARTTAACGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17468
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 21835478)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21265375 |
GRCz11 |
8 |
21297460 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTACCCCCTGTCTGTTTATCYTTTTCACYGCCTACAGAAATTCTTATGTT[C/T]GATTTCGYCACCTGTGCACRAACACTTGGATCCAAAGCACCAACATTCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41184
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 21835565)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21265462 |
GRCz11 |
8 |
21297547 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCACCAACATTCCTATCGACATCGATGAAGAGCGGCCGATTCGATTAATG[G/A]TGAAAAACTTTCCAACTATAATTTCACAGTTTCAACATTTCTGTATTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21271
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 21838507)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21268404 |
GRCz11 |
8 |
21300489 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAACCGAGAGAGACAGAAACTGATGAGAGAGCAGAACATTTTAAAACAG[G/T]TCGGATTTTTTTTTAATAATTTACAAGTTTGCCCGTTGAAACGTCTTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21272
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 21845951)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21275848 |
GRCz11 |
8 |
21307933 |
- KASP Assay ID:
- 2260-0491.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACTATTTAAACAATCAAAGGTGTAATAATGTTTGCTGTTTTATGTTATA[G/A]TTATGACTCTCACTTGGACTATTCACGAGACAATAAAAAGAACAAGTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21273
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 21846093)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21275990 |
GRCz11 |
8 |
21308075 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCATCGATGACCTGCCTTTTGCAAACGAGGAGAAAAACAAGCTAACGTA[T/A]GAGGTACTGTGGCATATTATTATGCTTTAGCTCCACTGGTAGTGCTTGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14415
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 21847842)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21277739 |
GRCz11 |
8 |
21309824 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTGGWCGAWCTGGAGACAGTCAAGTCGGCAGTAAAGACAGCATCGAYACA[C/T]AAGACATCACTGTCATGGACACCAAACTCAARATTCTGGAGATTTTACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21274
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 21852233)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21282130 |
GRCz11 |
8 |
21314215 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTGTTCAAGCACTTCAGTCAAAGACAAGAAGTCCTTCATACTTTTAAA[C/T]AGGTAAAAAAGCTGTGCCTAAATAGTTCAGATCAAACATCTGTAGGTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13385
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 21853548)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21283445 |
GRCz11 |
8 |
21315530 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGTTCTTTTCAGGTCCAATTGCTTATTTCAACTCAGGATGTGGACAACTA[T/A]AAACACATAAAACGAGATYTGGATCTGCTGCGCACCATGGTGGAGAAGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41185
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 21854737)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21284634 |
GRCz11 |
8 |
21316719 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGTGCGCACAAAGTTATGCTGGACCTGTTGCAGATCTCCTATGATCGGG[T/C]TTGTGGCCTTTTAAAGCATTCAAAACTCTACTAGATGTTTTGTAGCAAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45319
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 21860172)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21290069 |
GRCz11 |
8 |
21322154 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCATTTAATTCTCCTAATTTTCTCCTCATTATTCTTTTGTCTCGTTC[A/T]GGCTCATCACACCACTGTAAAGCAGCTGCTGCAGTCCACCATGCGTCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41186
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 21862502)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21292399 |
GRCz11 |
8 |
21324484 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCAAAGCGATTATGTGTGACTTCATGTTTTTCTCCTTTTGCTCTGAGC[A/T]GATTGATCCAGCACACAAAGGCCCTCATGAACTCCGATGAGAAGCTCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21275
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 8 (position 21865265)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21295162 |
GRCz11 |
8 |
21327247 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGGGGAAATGAGCAACAAAGCCAAAGATGACAAAGATCTGGAGACTGG[T/A]AATGCAACCCCACACTTGCTTCCTCTGTAAGGGACACTCCACTTTTTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15369
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 21870356)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
21300253 |
GRCz11 |
8 |
21332338 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TACAGTATTTTATTCTGGCTTTTTTATTGCAGCTCAAYCTGAACAAGCAG[C/T]AGGAGGAGGAAAAGGAGGATCCACTAGAGCACTACGACCRTCAAACTGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: