ENSDARG00000061741 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

itpr3

Ensembl ID:: ENSDARG00000061741
ZFIN ID:: ZDB-GENE-070605-1
Description:: inositol 1,4,5-triphosphate receptor, type 3 [Source:RefSeq peptide;Acc:NP_001121741]
Human Orthologue:: ITPR3
Human Description:: inositol 1,4,5-triphosphate receptor, type 3 [Source:HGNC Symbol;Acc:6182]
Mouse Orthologue:: Itpr3
Mouse Description:: inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI Symbol;Acc:MGI:96624]

Alleles

There are 15 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa41183	Nonsense	Mutation detected in F1 DNA	During 2018
sa11400	Nonsense	Available for shipment	Available now
sa17468	Nonsense	Available for shipment	Available now
sa41184	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa21271	Essential Splice Site	Available for shipment	Available now
sa21272	Essential Splice Site	Available for shipment	Available now
sa21273	Nonsense	Available for shipment	Available now
sa14415	Nonsense	Available for shipment	Available now
sa21274	Splice Site, Nonsense	Available for shipment	Available now
sa13385	Nonsense	Available for shipment	Available now
sa41185	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa45319	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa41186	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa21275	Essential Splice Site	Available for shipment	Available now
sa15369	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa41183
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Nonsense	105	2656	4	59
ENSDART00000088133	Nonsense	102	226	6	8
ENSDART00000129359	Nonsense	102	232	6	7
ENSDART00000142836		None	2293	None	48
ENSDART00000144488	Nonsense	102	332	4	10

Genomic Location (Zv9):

Chromosome 8 (position 21822788)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21252685
GRCz11	8	21284770

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TAATTGATTTGTTTATTCTTCTCCTACAAAAGCATGCAGCTAATTTGGAA[C/T]AAAAGCAGAATGATGCTGAGAACAAAAAGGTCCACGGCGATGTGGTTAAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa11400
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Nonsense	203	2656	6	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836		None	2293	None	48
ENSDART00000144488	Nonsense	200	332	6	10

Genomic Location (Zv9):

Chromosome 8 (position 21829893)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21259790
GRCz11	8	21291875

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GTGATCCTGAATCCTGTGAATGCTGGACAGCCTCTCCATGCCAGCAGCTA[T/A]GAGCTTCCCGATCAYTCAGGGTGCAAAGAGGTTTGCGATRARTTAACGAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa17468
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Nonsense	395	2656	13	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Nonsense	45	2293	2	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21835478)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21265375
GRCz11	8	21297460

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TTACCCCCTGTCTGTTTATCYTTTTCACYGCCTACAGAAATTCTTATGTT[C/T]GATTTCGYCACCTGTGCACRAACACTTGGATCCAAAGCACCAACATTCCT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa41184
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Essential Splice Site	423	2656	13	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Essential Splice Site	73	2293	2	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21835565)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21265462
GRCz11	8	21297547

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GCACCAACATTCCTATCGACATCGATGAAGAGCGGCCGATTCGATTAATG[G/A]TGAAAAACTTTCCAACTATAATTTCACAGTTTCAACATTTCTGTATTTTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21271
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Essential Splice Site	524	2656	15	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Essential Splice Site	174	2293	4	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21838507)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21268404
GRCz11	8	21300489

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CCAACCGAGAGAGACAGAAACTGATGAGAGAGCAGAACATTTTAAAACAG[G/T]TCGGATTTTTTTTTAATAATTTACAAGTTTGCCCGTTGAAACGTCTTGTT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21272
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Essential Splice Site	821	2656	21	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Essential Splice Site	471	2293	10	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21845951)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21275848
GRCz11	8	21307933

KASP Assay ID:

2260-0491.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GACTATTTAAACAATCAAAGGTGTAATAATGTTTGCTGTTTTATGTTATA[G/A]TTATGACTCTCACTTGGACTATTCACGAGACAATAAAAAGAACAAGTTTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21273
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Nonsense	868	2656	21	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Nonsense	518	2293	10	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21846093)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21275990
GRCz11	8	21308075

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CTCATCGATGACCTGCCTTTTGCAAACGAGGAGAAAAACAAGCTAACGTA[T/A]GAGGTACTGTGGCATATTATTATGCTTTAGCTCCACTGGTAGTGCTTGGG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa14415
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Nonsense	964	2656	23	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Nonsense	613	2293	12	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21847842)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21277739
GRCz11	8	21309824

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CTGGWCGAWCTGGAGACAGTCAAGTCGGCAGTAAAGACAGCATCGAYACA[C/T]AAGACATCACTGTCATGGACACCAAACTCAARATTCTGGAGATTTTACAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21274
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Splice Site, Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Splice Site, Nonsense	1097	2656	26	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Splice Site, Nonsense	741	2293	15	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21852233)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21282130
GRCz11	8	21314215

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGCTGTTCAAGCACTTCAGTCAAAGACAAGAAGTCCTTCATACTTTTAAA[C/T]AGGTAAAAAAGCTGTGCCTAAATAGTTCAGATCAAACATCTGTAGGTAAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa13385
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Nonsense	1110	2656	27	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Nonsense	754	2293	16	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21853548)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21283445
GRCz11	8	21315530

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TGTTCTTTTCAGGTCCAATTGCTTATTTCAACTCAGGATGTGGACAACTA[T/A]AAACACATAAAACGAGATYTGGATCTGCTGCGCACCATGGTGGAGAAGTC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa41185
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Essential Splice Site	1219	2656	29	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Essential Splice Site	863	2293	18	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21854737)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21284634
GRCz11	8	21316719

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GGGTGCGCACAAAGTTATGCTGGACCTGTTGCAGATCTCCTATGATCGGG[T/C]TTGTGGCCTTTTAAAGCATTCAAAACTCTACTAGATGTTTTGTAGCAAGT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa45319
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Essential Splice Site	1496	2656	35	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Essential Splice Site	1140	2293	24	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21860172)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21290069
GRCz11	8	21322154

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TTCTCATTTAATTCTCCTAATTTTCTCCTCATTATTCTTTTGTCTCGTTC[A/T]GGCTCATCACACCACTGTAAAGCAGCTGCTGCAGTCCACCATGCGTCTGT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa41186
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Essential Splice Site	1649	2656	38	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Essential Splice Site	1290	2293	27	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21862502)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21292399
GRCz11	8	21324484

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AAGCAAAGCGATTATGTGTGACTTCATGTTTTTCTCCTTTTGCTCTGAGC[A/T]GATTGATCCAGCACACAAAGGCCCTCATGAACTCCGATGAGAAGCTCTGT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa21275
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119		1828	2656	41	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Essential Splice Site	1469	2293	None	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21865265)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21295162
GRCz11	8	21327247

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GTGGGGGAAATGAGCAACAAAGCCAAAGATGACAAAGATCTGGAGACTGG[T/A]AATGCAACCCCACACTTGCTTCCTCTGTAAGGGACACTCCACTTTTTTTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa15369
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000088119	Nonsense	2094	2656	48	59
ENSDART00000088133		None	226	None	8
ENSDART00000129359		None	232	None	7
ENSDART00000142836	Nonsense	1722	2293	37	48
ENSDART00000144488		None	332	None	10

Genomic Location (Zv9):

Chromosome 8 (position 21870356)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	8	21300253
GRCz11	8	21332338

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TACAGTATTTTATTCTGGCTTTTTTATTGCAGCTCAAYCTGAACAAGCAG[C/T]AGGAGGAGGAAAAGGAGGATCCACTAGAGCACTACGACCRTCAAACTGCT

Associated Phenotype:

Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Obesity (extreme): Common body mass index-associated variants confer risk of extreme obesity. (View Study)
Phosphorus levels: Common genetic variants associate with serum phosphorus concentration. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

Diabetes, type 1, susceptibility to

More OMIM information for ITPR3

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: