zgc:154079

Ensembl ID:
ENSDARG00000061737
ZFIN ID:
ZDB-GENE-061110-100
Description:
endothelin-converting enzyme 1 [Source:RefSeq peptide;Acc:NP_001071260]
Human Orthologue:
ECE1
Human Description:
endothelin converting enzyme 1 [Source:HGNC Symbol;Acc:3146]
Mouse Orthologue:
Ece1
Mouse Description:
endothelin converting enzyme 1 Gene [Source:MGI Symbol;Acc:MGI:1101357]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35104 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11416 Nonsense Available for shipment Available now
sa21930 Essential Splice Site Available for shipment Available now
sa9969 Nonsense Available for shipment Available now
sa35103 Essential Splice Site Mutation detected in F1 DNA During 2018
sa5844 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11183 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088329 Essential Splice Site 147 752 4 19
ENSDART00000136859 Essential Splice Site 192 797 4 19
ENSDART00000147386   None 142 None 4
Genomic Location (Zv9):
Chromosome 11 (position 28816705)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27692691
GRCz11 11 27939865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCAACCTGTGGGAACATAACATGGCTGTCATGAAGAACTTGCTAGG[T/G]AAGAAAAACACAACGAAGAAATAGTTGTATTATTTTAATACTGCTTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088329 Nonsense 207 752 6 19
ENSDART00000136859 Nonsense 252 797 6 19
ENSDART00000147386   None 142 None 4
Genomic Location (Zv9):
Chromosome 11 (position 28814824)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27690810
GRCz11 11 27937984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTGGGGCTTGAAAGGCCCGTGGGAGAAGGATAACTTCCAGGAGGTTT[T/A]ACGGATTGTGTCAGCCAACTTCCGAACCTCTCCCTTKTTCACTGTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088329 Essential Splice Site 260 752 8 19
ENSDART00000136859 Essential Splice Site 305 797 8 19
ENSDART00000147386   None 142 None 4
Genomic Location (Zv9):
Chromosome 11 (position 28812766)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27688752
GRCz11 11 27935926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAAACGTTGTGCTGTGGTCTAAAGCTGGTGTTGTCATTCCTCCTTTA[G/A]TATTTAAATGCTTACTTGAACTTTTTGGTGGAACTTGGAGTCCTCTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088329 Nonsense 324 752 9 19
ENSDART00000136859 Nonsense 369 797 9 19
ENSDART00000147386   None 142 None 4
Genomic Location (Zv9):
Chromosome 11 (position 28810937)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27686923
GRCz11 11 27934097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTGGAAATCCTCATCAGTGATGTGTTTRTATGTTGTGCTGCAGACAT[T/A]GGCTCCTGCCATAGACTGGATGCCTTTCCTSTCTTCTGTTTTTGCCCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088329 Essential Splice Site 408 752 10 19
ENSDART00000136859 Essential Splice Site 453 797 10 19
ENSDART00000147386   None 142 None 4
Genomic Location (Zv9):
Chromosome 11 (position 28810558)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27686544
GRCz11 11 27933718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGATGCAGAGCAGCGTTTCCTTGAAGTCATGTACGGCACCAAGAAGG[T/C]AAGAAATGAAGATCAAAGCTGTCATCTGTCAGCCTGAAGCAAAACTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088329 Essential Splice Site 576 752 15 19
ENSDART00000136859 Essential Splice Site 621 797 15 19
ENSDART00000147386   None 142 None 4
Genomic Location (Zv9):
Chromosome 11 (position 28802064)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27678050
GRCz11 11 27925224
KASP Assay ID:
554-3800.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGCAGGCATTTTCCAGGCTCCCTTTTACAACCACGCTTGGCCAAAG[T/C]AAGATTGTTTTCCATTAACAAAACCCTCACCTGCTTATTAAGCCTYGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088329 Nonsense 599 752 16 19
ENSDART00000136859 Nonsense 644 797 16 19
ENSDART00000147386   None 142 None 4
Genomic Location (Zv9):
Chromosome 11 (position 28801898)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27677884
GRCz11 11 27925058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATAGGTGTGGTTATGGGGCACGAACTCACCCATGCTTTTGATGATCAA[G/T]GTCATTTATTATTCCTTATTTCAGATCTGCTKTGTGAGACTCAGTCAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link