acot13

Ensembl ID:
ENSDARG00000061728
ZFIN ID:
ZDB-GENE-060503-437
Description:
acyl-coenzyme A thioesterase 13 [Source:RefSeq peptide;Acc:NP_001074272]
Human Orthologue:
ACOT13
Human Description:
acyl-CoA thioesterase 13 [Source:HGNC Symbol;Acc:20999]
Mouse Orthologue:
Acot13
Mouse Description:
acyl-CoA thioesterase 13 Gene [Source:MGI Symbol;Acc:MGI:1914084]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31035 Nonsense Mutation detected in F1 DNA During 2018
sa43305 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088401 Nonsense 26 144 1 3
ENSDART00000134107 Nonsense 26 141 1 3
ENSDART00000088401 Nonsense 26 144 1 3
ENSDART00000134107 Nonsense 26 141 1 3
Genomic Location (Zv9):
Chromosome 19 (position 32822407)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31989696
GRCz11 19 31577009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACAGATCTTCAGAGCGATGGCGGACAGTCCTGGGTTTGACCGGGTTT[T/A]AAGTAAGGTGAGTGTTTGTGGTTCTCCTTGAGGGTCCTGCCAGACCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088401 Nonsense 26 144 1 3
ENSDART00000134107 Nonsense 26 141 1 3
ENSDART00000088401 Nonsense 26 144 1 3
ENSDART00000134107 Nonsense 26 141 1 3
Genomic Location (Zv9):
Chromosome 19 (position 32822407)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31989696
GRCz11 19 31577009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACAGATCTTCAGAGCGATGGCGGACAGTCCTGGGTTTGACCGGGTTT[T/A]AAGTAAGGTGAGTGTTTGTGGTTCTCCTTGAGGGTCCTGCCAGACCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link