si:dkey-149j18.1
- Ensembl ID:
- ENSDARG00000061699
- ZFIN ID:
- ZDB-GENE-050420-109
- Description:
- Novel protein similar to vertebrate signal-induced proliferation-associated 1 like family [Source:Un
- Human Orthologue:
- SIPA1L3
- Human Description:
- signal-induced proliferation-associated 1 like 3 [Source:HGNC Symbol;Acc:23801]
- Mouse Orthologue:
- Sipa1l3
- Mouse Description:
- signal-induced proliferation-associated 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:1921456]
Alleles
There are 7 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa23346 |
Essential Splice Site |
Available for shipment |
Available now |
sa36697 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa15094 |
Nonsense |
Available for shipment |
Available now |
sa45646 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa43151 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa43150 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa23347 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa23346
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000088293 |
Essential Splice Site |
455 |
1718 |
None |
20 |
ENSDART00000147385 |
Essential Splice Site |
415 |
1678 |
None |
20 |
- Genomic Location (Zv9):
- Chromosome 18 (position 35461174)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
18 |
37140330 |
GRCz11 |
18 |
37121338 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACGTTGACCTGGGGGCCAGAAACTACCATGAGCACTTCTATGGGAAAGG[T/A]AAGAAATCTATTGCTTCCATCTAGATAATACATTACACTACGAGATGTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36697
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 18 (position 35483600)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
18 |
37162756 |
GRCz11 |
18 |
37143764 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTGTTTTATAGCGGACTCAACTGGAACACACTCCCTGTACACCACCTA[T/A]CAGGACTATGAGATCATGTTTCACGTGTCCACCATGCTTCCATACATGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15094
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 18 (position 35518137)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
18 |
37197293 |
GRCz11 |
18 |
37178301 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGCGGAGCCAGTGGCCGCAGGCTATCGAGCAGKGCAGCGAACCCCAGTAT[G/A]GCGCTGGGACAGTCCTCCTGCTACTCACAGCTCTGCCCAGCGCTGGACCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45646
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 18 (position 35518418)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
18 |
37197574 |
GRCz11 |
18 |
37178582 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTATTTCTGTCTCCTCCCACAGGCCTGTCAGTTATCCAGAAAACCATTA[C/A]AGCGTGTCTCCTCTTGCTGGGGACAGAGGGCCGTACAGAAACCCTTCGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43151
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 18 (position 35536937)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
18 |
37216093 |
GRCz11 |
18 |
37197101 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGCTATCGTACTGATTTGTTGTTGTTGTGTGTGTGTGTGCTTGTCTCC[A/T]GTCTCCTCATCGGACACTGCAGCGCACTTTCTCAGATGAGAGTCTGTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43150
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 18 (position 35536937)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
18 |
37216093 |
GRCz11 |
18 |
37197101 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGCTATCGTACTGATTTGTTGTTGTTGTGTGTGTGTGTGCTTGTCTCC[A/T]GTCTCCTCATCGGACACTGCAGCGCACTTTCTCAGATGAGAGTCTGTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23347
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 18 (position 35537319)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
18 |
37216475 |
GRCz11 |
18 |
37197483 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAGGCTGGATCCTGGACTCATGCCTCTTCCTGACACTGCCTGTGGTCTC[G/T]AGTGGTCCAGCCTCGTCAATGCAGCCAAAGCTTATGAAGGTACGAGTGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: