
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-149j18.2
- Ensembl ID:
- ENSDARG00000061691
- ZFIN ID:
- ZDB-GENE-030131-1441
- Description:
- glutaminyl-peptide cyclotransferase-like [Source:RefSeq peptide;Acc:NP_001038418]
- Human Orthologue:
- QPCTL
- Human Description:
- glutaminyl-peptide cyclotransferase-like [Source:HGNC Symbol;Acc:25952]
- Mouse Orthologue:
- Qpctl
- Mouse Description:
- glutaminyl-peptide cyclotransferase-like Gene [Source:MGI Symbol;Acc:MGI:1914619]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43152 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43152
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088247 | Nonsense | 90 | 392 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 18 (position 35563327)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 37242483 GRCz11 18 37223491 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCATAAGCCAAATAAATACTCTGTGGCACAAGCCAAGAAACTGGCAGGA[C/T]AGGTGGATGGGCATCGGCTTTGGGAGACTCACTTGCGGCCCCTGCTAATT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
- Body mass index: Meta-analysis identifies common variants associated with body mass index in east Asians. (View Study)
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: