zgc:153086

Ensembl ID:
ENSDARG00000061690
ZFIN ID:
ZDB-GENE-061013-214
Description:
Protein FAM55C [Source:UniProtKB/Swiss-Prot;Acc:Q08BN9]
Human Orthologue:
FAM55C
Human Description:
family with sequence similarity 55, member C [Source:HGNC Symbol;Acc:28238]
Mouse Orthologue:
Fam55c
Mouse Description:
family with sequence similarity 55, member C Gene [Source:MGI Symbol;Acc:MGI:2686598]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1755 Essential Splice Site Available for shipment Available now
sa21533 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088261 Essential Splice Site None 566 1 6
ENSDART00000132836 Essential Splice Site None 567 1 6
ENSDART00000139157   None 156 None 3
Genomic Location (Zv9):
Chromosome 9 (position 35204049)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34423560
GRCz11 9 34232745
KASP Assay ID:
554-1748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTGTCAGCAGCAGCGGCGCTKCAGTACTGCAACATCGTTGCAGATGG[T/G]GAGTATATTMAGTCACCATATTTGGCTATAGCCCCCAACATTTAGACAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088261 Nonsense 29 566 2 6
ENSDART00000132836 Nonsense 30 567 2 6
ENSDART00000139157 Nonsense 30 156 2 3
Genomic Location (Zv9):
Chromosome 9 (position 35208148)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34427659
GRCz11 9 34236844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGCTGGCGCTGTCAGGACTGCTGTATCTGCTGTGGAGCATCACCT[C/A]GCTGGAGGTGAGCAGAAGTCTCAGCTTGACTTTTAGATGGTGGTTTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link