zgc:162641

Ensembl ID:
ENSDARG00000061684
ZFIN ID:
ZDB-GENE-070620-4
Description:
hypothetical protein LOC100093708 [Source:RefSeq peptide;Acc:NP_001092731]
Human Orthologue:
SLC25A17
Human Description:
solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17 [So
Mouse Orthologue:
Slc25a17
Mouse Description:
solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17 Gene [Sour

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14105 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088238 Essential Splice Site 114 311 4 10
Genomic Location (Zv9):
Chromosome 3 (position 24974322)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24552533
GRCz11 3 24683081
KASP Assay ID:
2259-3419.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCAMAGATCAACAGCAGGGCGGGACCTTATTATTGGCATTGCTGCAGG[T/C]TTGCTTGTTAAAAAATACTGAATGATTTAAAACAGATAAAATAGCATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link