
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-334d15.1
- Ensembl ID:
- ENSDARG00000061672
- ZFIN ID:
- ZDB-GENE-091118-35
- Human Orthologue:
- UGT8
- Human Description:
- UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
- Mouse Orthologue:
- Ugt8a
- Mouse Description:
- UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30131 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44178 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30131
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088204 | Nonsense | 88 | 534 | 1 | 1 |
ENSDART00000135142 | Nonsense | 88 | 534 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 24 (position 38220433)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 36835099 GRCz11 24 36722855 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCCACACTACACCTCAATAACGGTGACCCTATCAGAAGCAATAAACATC[G/T]AGAAGCCCGATTTCTTCATCTCGTTCCTCAGCCAAATGATCGAGATACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44178
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088204 | Nonsense | 262 | 534 | 1 | 1 |
ENSDART00000135142 | Nonsense | 262 | 534 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 24 (position 38219910)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 36834576 GRCz11 24 36722332 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTGGACCCGAAATCGATTTCTTCAACTTGCTGCAAGGTGCTGATATTT[G/A]GCTCATTAGGTCGGATTTTATCTTCGAATTTCCCCGTCCGACGATGCCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: