zgc:162707

Ensembl ID:
ENSDARG00000061664
ZFIN ID:
ZDB-GENE-070424-37
Description:
UPF0524 protein C3orf70 homolog B [Source:UniProtKB/Swiss-Prot;Acc:A3KNX6]
Human Orthologue:
C3orf70
Human Description:
chromosome 3 open reading frame 70 [Source:HGNC Symbol;Acc:33731]
Mouse Orthologue:
2510009E07Rik
Mouse Description:
RIKEN cDNA 2510009E07 gene Gene [Source:MGI Symbol;Acc:MGI:1919440]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41366 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088199 Nonsense 226 249 3 3
ENSDART00000135447   None 122 None 4
Genomic Location (Zv9):
Chromosome 9 (position 12681568)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12434133
GRCz11 9 12405336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGAGCTCAGCACGGATGGACACTCCAGTCCGGGGAGTCTATGGGAC[C/T]AGGATGAATGCACCCTGCTGTCCCCTTCCAAATCTATGGTGGAGATTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link