zgc:158271

Ensembl ID:
ENSDARG00000061656
ZFIN ID:
ZDB-GENE-070112-632
Description:
Protein tyrosine phosphatase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A1L1R5]
Human Orthologue:
PTPDC1
Human Description:
protein tyrosine phosphatase domain containing 1 [Source:HGNC Symbol;Acc:30184]
Mouse Orthologue:
Ptpdc1
Mouse Description:
protein tyrosine phosphatase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2145430]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14206 Nonsense Available for shipment Available now
sa16175 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088177 Nonsense 541 713 7 10
ENSDART00000141320   None 169 None 6

The following transcripts of ENSDARG00000061656 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 28393684)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27269670
GRCz11 11 27516844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACRCAACATTTCAAGGATGTTCCCATTTTAACRCTTCAGAGTGAACTCT[C/A]GCCTGAGAYTCGTCATCTGTTTGTGGCCAAAGCTCTCACTGTGGACCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088177 Nonsense 569 713 7 10
ENSDART00000141320   None 169 None 6

The following transcripts of ENSDARG00000061656 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 28393599)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27269585
GRCz11 11 27516759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACTGTGGACCTTGATGGAGAGGAACTCAGGAGTAAAGTCTCAGTGTG[G/A]CAGGTAGGAGTGTGCAGTAGATATTTGAGTCTTCAATTCTTTATCACGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link