zgc:158241

Ensembl ID:
ENSDARG00000061654
ZFIN ID:
ZDB-GENE-070209-229
Description:
protein WWC3 [Source:RefSeq peptide;Acc:NP_001103940]
Human Orthologue:
WWC3
Human Description:
WWC family member 3 [Source:HGNC Symbol;Acc:29237]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33885 Essential Splice Site Available for shipment Available now
sa40713 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20721 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088142 Essential Splice Site 654 1148 12 23
Genomic Location (Zv9):
Chromosome 6 (position 30266771)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30587687
GRCz11 6 30574601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGATGTTTTGGCAACAGACAGCGGGGTATTTGAAGCCTGGAGTAGAAG[G/T]TGAGATGCGAATTTACAGTTTACCAGAAATTCAATTCTGTCATCCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088142 Essential Splice Site 712 1148 15 23
Genomic Location (Zv9):
Chromosome 6 (position 30268938)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30589854
GRCz11 6 30576768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTACACTTTACGCACATTTGTCATTATCTCCATGTTGCTCTCTCTCA[G/T]ATTTGTGAAGGTTCATGTTCTCCCGATGGACTCCAGTCGGCCCTGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088142 Nonsense 1111 1148 22 23
Genomic Location (Zv9):
Chromosome 6 (position 30282665)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30603581
GRCz11 6 30590495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAGGCTGCTGAGAGGAGGTTGAGAAAGGCTTCAAAAGAGGTCTTA[C/T]AAATGAGGGGCCAGAGCCACAAAGAGCCCCTTCCTGTGCAGACATTCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link