SIPA1L2 (2 of 3)

Ensembl ID:
ENSDARG00000061640
Description:
signal-induced proliferation-associated 1 like 2 [Source:HGNC Symbol;Acc:23800]
Human Orthologue:
SIPA1L2
Human Description:
signal-induced proliferation-associated 1 like 2 [Source:HGNC Symbol;Acc:23800]
Mouse Orthologue:
Sipa1l2
Mouse Description:
signal-induced proliferation-associated 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2676970]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6215 Nonsense Mutation detected in F1 DNA During 2018
sa9835 Nonsense Available for shipment Available now
sa30951 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088093 Nonsense 2 1672 1 20
Genomic Location (Zv9):
Chromosome 11 (position 32205626)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31117491
GRCz11 11 31380551
KASP Assay ID:
554-4632.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATACAGACGAGGCCATAGAAGCTTGAGAAGCGCCTCACMGCARAAATG[C/T]AGACCGATGATCTATTTGCCAAAAAGCTTCAAGCTTTAAATGGGAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088093 Nonsense 339 1672 1 20
Genomic Location (Zv9):
Chromosome 11 (position 32206639)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31118504
GRCz11 11 31381564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGATGGTCCTGACCCCTTGCCTCTTTGCGAGTCCCCTTTGGACAACTG[T/A]GAGGAGCTTGGGCAAAAAGCTTGCACTGATCCCRATGARGGAGATGGRAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088093 Nonsense 1389 1672 14 20
Genomic Location (Zv9):
Chromosome 11 (position 32261038)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31172903
GRCz11 11 31435963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATTCAACTGGCTGGAAGAAAGGAGAAAATGAGCACTTGCTGGAAGAT[C/T]AAGGGCAAGCTAGAGACTTTAGGTAAGTAGCTCTAAATGACTAATGCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link