zgc:158614

Ensembl ID:
ENSDARG00000061634
ZFIN ID:
ZDB-GENE-070112-2282
Description:
hypothetical protein LOC791218 [Source:RefSeq peptide;Acc:NP_001074169]
Human Orthologue:
AIFM3
Human Description:
apoptosis-inducing factor, mitochondrion-associated, 3 [Source:HGNC Symbol;Acc:26398]
Mouse Orthologue:
Aifm3
Mouse Description:
apoptosis-inducing factor, mitochondrion-associated 3 Gene [Source:MGI Symbol;Acc:MGI:1919418]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39048 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18535 Essential Splice Site Available for shipment Available now
sa22650 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125485 Essential Splice Site 49 456 3 18
ENSDART00000125955 Essential Splice Site 60 530 2 18
Genomic Location (Zv9):
Chromosome 15 (position 24771104)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25504746
GRCz11 15 25440011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCTGTCGGTGGTCTTTGCTCTCATTATGGTGCTCCACTTATCAAAGG[T/C]AGGGTGTAGTCTTATTAATCACACAAGCTGTCACAAGCTGAACAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125485 Essential Splice Site 266 456 None 18
ENSDART00000125955 Essential Splice Site 340 530 None 18
Genomic Location (Zv9):
Chromosome 15 (position 24776403)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25510045
GRCz11 15 25445310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTACACAAGTAATGGTGTGGCTGAAATTCGAGGTGAAAATGGAAAGG[T/C]ACTGCAAGAAGAAACATTATTTTTAAATGATCATAGAKCTGAAGTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125485 Splice Site, Nonsense 411 456 16 18
ENSDART00000125955 Splice Site, Nonsense 485 530 16 18
Genomic Location (Zv9):
Chromosome 15 (position 24778085)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25511727
GRCz11 15 25446992
KASP Assay ID:
2260-8536.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTCAAAGGAAGTACGGAGGAAAGAAAATTCTTGGCATTTTATATT[A/T]AGTAAGCTAATAGTTCAACAAGAAATCACTTGACTTTTCATATGTGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link