
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:163003
- Ensembl ID:
- ENSDARG00000061610
- ZFIN ID:
- ZDB-GENE-070410-124
- Description:
- inactive Ufm1-specific protease 1 [Source:RefSeq peptide;Acc:NP_001082999]
- Human Orthologue:
- UFSP1
- Human Description:
- UFM1-specific peptidase 1 (non-functional) [Source:HGNC Symbol;Acc:33821]
- Mouse Orthologue:
- Ufsp1
- Mouse Description:
- UFM1-specific peptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1917490]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40873 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40873
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088041 | Missense | 120 | 248 | 1 | 1 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 23086770)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 21651955 GRCz11 7 21918293 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACCAAGTATTTCCGAAATACAGCAGACTTTGGTGGAAATAGGAGACAAA[C/A]CTGATTCATTCCTGGGCTCCAGGGAGTGGATCGGGACGTTTGAGGCTAGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Plasminogen activator inhibitor type 1 levels (PAI-1): Genome-wide association study for circulating levels of PAI-1 provides novel insights into its regulation. (View Study)
- Resting heart rate: Genome-wide association analysis identifies multiple loci related to resting heart rate. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: