zgc:154042

Ensembl ID:
ENSDARG00000061585
ZFIN ID:
ZDB-GENE-061103-88
Description:
cytochrome P450, family 4, subfamily v, polypeptide 2 [Source:RefSeq peptide;Acc:NP_001073465]
Human Orthologue:
CYP4V2
Human Description:
cytochrome P450, family 4, subfamily V, polypeptide 2 [Source:HGNC Symbol;Acc:23198]
Mouse Orthologue:
Cyp4v3
Mouse Description:
cytochrome P450, family 4, subfamily v, polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:2142763]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14166 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087976 Nonsense 354 510 9 11
Genomic Location (Zv9):
Chromosome 14 (position 30854368)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29644425
GRCz11 14 29984739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGCTGGGAAATGGTTKCTGACAAATTCATTCTGATTGGCAGGTTCAT[C/A]GGAGCGCCATGTGGGGGTGGAGGACCTGAAAAAGCTGCGCTACCTGGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link