zgc:153943

Ensembl ID:
ENSDARG00000061553
ZFIN ID:
ZDB-GENE-061013-692
Description:
hypothetical protein LOC768199 [Source:RefSeq peptide;Acc:NP_001070809]
Human Orthologue:
C9orf125
Human Description:
chromosome 9 open reading frame 125 [Source:HGNC Symbol;Acc:28180]
Mouse Orthologue:
2810432L12Rik
Mouse Description:
RIKEN cDNA 2810432L12 gene Gene [Source:MGI Symbol;Acc:MGI:1914313]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6214 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087909 Nonsense 183 396 2 2
Genomic Location (Zv9):
Chromosome 11 (position 31515499)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30392861
GRCz11 11 30640045
KASP Assay ID:
554-4986.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGCTATTGCAGGGCAGAGAAGTTTCCGACATATTTGAGAGGGAAAAA[C/T]AAGATTACGTTTTCTGCCTACGCAAAGGATGGGACATGATGAAGCCAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link