zgc:153898

Ensembl ID:
ENSDARG00000061551
ZFIN ID:
ZDB-GENE-061013-179
Description:
zgc:153898 (zgc:153898), mRNA [Source:RefSeq DNA;Acc:NM_001077555]
Human Orthologue:
RAP1GAP2
Human Description:
RAP1 GTPase activating protein 2 [Source:HGNC Symbol;Acc:29176]
Mouse Orthologue:
Rap1gap2
Mouse Description:
RAP1 GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:3028623]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39055 Nonsense Mutation detected in F1 DNA During 2018
sa32040 Nonsense Available for shipment Available now
sa22667 Nonsense Available for shipment Available now
sa35910 Essential Splice Site Mutation detected in F1 DNA During 2018
sa2799 Essential Splice Site F2 line generated During 2018
sa18310 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099895   None 472 None 15
ENSDART00000126559 Nonsense 32 700 3 23
ENSDART00000137817   None 629 None 19

The following transcripts of ENSDARG00000061551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28619129)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29337159
GRCz11 15 29270035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAAACAAGAGTTGCTGACCATCTCCAGTGTGCCTCTGGGAGAATG[T/A]CCACCTTCACCTCCCCGCACTGCACCCCCCACCATGAAGGTGAGTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099895 Nonsense 71 472 4 15
ENSDART00000126559 Nonsense 122 700 6 23
ENSDART00000137817 Nonsense 65 629 2 19

The following transcripts of ENSDARG00000061551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28643594)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29361624
GRCz11 15 29294500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCTGTGAGGAGGAGAATGATGATCTGAGTCCCAGTGGAGGAGGAGGT[G/T]GAGGAGGATTCGGATACAGGATGGAGTGTAACAGCACGTCACGAGCCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099895 Nonsense 85 472 4 15
ENSDART00000126559 Nonsense 136 700 6 23
ENSDART00000137817 Nonsense 79 629 2 19

The following transcripts of ENSDARG00000061551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28643636)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29361666
GRCz11 15 29294542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGTGGAGGAGGATTCGGATACAGGATGGAGTGTAACAGCACGTCA[C/T]GAGCCTATCGCAAACACTTTCTTGGAAAGGTGAGGTTGCATTTGTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099895 Essential Splice Site 201 472 8 15
ENSDART00000126559 Essential Splice Site 252 700 10 23
ENSDART00000137817 Essential Splice Site 195 629 6 19

The following transcripts of ENSDARG00000061551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28646376)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29364406
GRCz11 15 29297282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAACAACACTTTCAAGTTTGGAGTCATTTATCAGAAGTTCGGTCAG[G/T]TGAGAGTTGCTTTCTTCAGTTTCAGACTTCCTCCTTTTCTCATTTATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2799
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099895 Essential Splice Site 330 472 11 15
ENSDART00000126559 Essential Splice Site 381 700 13 23
ENSDART00000137817 Essential Splice Site 324 629 9 19

The following transcripts of ENSDARG00000061551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28650669)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29368699
GRCz11 15 29301575
KASP Assay ID:
554-2844.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATTAGTGCAGGCAGAAAACCCTTGCACCGATCACACAACATACAAGG[T/A]TTGTCAACAAGCAGCTCACTTAATTACATCCAGATGGCCATCAATCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099895 Essential Splice Site 354 472 12 15
ENSDART00000126559 Essential Splice Site 405 700 14 23
ENSDART00000137817 Essential Splice Site 348 629 10 19

The following transcripts of ENSDARG00000061551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28650830)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29368860
GRCz11 15 29301736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACRTCCCACCATTMGRCCCCCCTCTGCCAAACCCCTCAGTCTTTAAGAAG[G/A]TAATGTTAGAAGACTAGTTCTAGTGAAATKTGGCAGCAGATGATGAWGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link