zgc:165555

Ensembl ID:
ENSDARG00000061547
ZFIN IDs:
ZDB-GENE-030131-5068, ZDB-GENE-030131-5087, ZDB-GENE-060929-1050, ZDB-GENE-060929-224, ZDB-GENE-070424-79, ZDB-GENE-070620-17, ZDB-GENE-070927-10
Description:
histone cluster 1, H4-like [Source:RefSeq peptide;Acc:NP_001092231]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45204 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087894 Nonsense 56 103 1 1
Genomic Location (Zv9):
Chromosome 5 (position 29074624)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26829922
GRCz11 5 27430075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGTCGTGGCGGTGTAAAGCGTATTTCTGGTCTGATCTATGAAGAGACT[C/T]GAGGTGTGCTGAAAGTGTTCCTGGAAAACGTCATTCGCGACGCTGTGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link