unc5db

Ensembl ID:
ENSDARG00000061541
ZFIN ID:
ZDB-GENE-060531-162
Description:
Novel unc-5 homolog family protein [Source:UniProtKB/TrEMBL;Acc:A3KPR8]
Human Orthologue:
UNC5CL
Human Description:
unc-5 homolog C (C. elegans)-like [Source:HGNC Symbol;Acc:21203]
Mouse Orthologue:
Unc5cl
Mouse Description:
unc-5 homolog C (C. elegans)-like Gene [Source:MGI Symbol;Acc:MGI:1923839]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45203 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25298 Nonsense Mutation detected in F1 DNA During 2018
sa7566 Missense Mutation detected in F1 DNA During 2018
sa31441 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Essential Splice Site 543 901 10 16
Genomic Location (Zv9):
Chromosome 5 (position 29003860)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26759158
GRCz11 5 27359311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACACCTCTTGGGAAATGTACATGCTCATAAATCAAGGAGAGACTAGG[T/C]AAGACTGTACACTGACACAGCTGTTCTGTGTTCATATTTCTTGTTCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Nonsense 692 901 13 16
Genomic Location (Zv9):
Chromosome 5 (position 29030009)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26785307
GRCz11 5 27385460
KASP Assay ID:
554-7824.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGGGAGTGGTCACAGCTGAAACCTGCAGAGGAGGTCAGCTTTTAGAA[G/T]AGCCCAAGACACTGTTCTTCAAAGGAAACTGCCTCAGTCTGCAGGTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Missense 730 901 14 16
Genomic Location (Zv9):
Chromosome 5 (position 29033163)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26788461
GRCz11 5 27388614
KASP Assay ID:
554-4064.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTCTCTGATTTCTCTCTCTCYCTTTTGTTCTGCTGCAGGAATTCTCC[T/C]TCACCCAAGTGTGGTATAGTAACCAGCAGCCTGTGCACTGTGCCTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087857 Nonsense 849 901 16 16
Genomic Location (Zv9):
Chromosome 5 (position 29042000)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26797298
GRCz11 5 27397451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAAATCTCCATTTCTGTCTGCACAGGAATCTGTCCTACTTCACCAAA[C/T]AGAAGAGTCCCTCTGCTGTCATTCTCAGTCTCTGGGAAGCCAGACATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Esophageal cancer: Genome-wide association study identifies three new susceptibility loci for esophageal squamous-cell carcinoma in Chinese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link