zgc:153172

Ensembl ID:
ENSDARG00000061505
ZFIN ID:
ZDB-GENE-060825-257
Description:
28S ribosomal protein S9, mitochondrial [Source:RefSeq peptide;Acc:NP_001038861]
Human Orthologue:
MRPS9
Human Description:
mitochondrial ribosomal protein S9 [Source:HGNC Symbol;Acc:14501]
Mouse Orthologue:
Mrps9
Mouse Description:
mitochondrial ribosomal protein S9 Gene [Source:MGI Symbol;Acc:MGI:1916777]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16115 Essential Splice Site Available for shipment Available now
sa11979 Essential Splice Site Available for shipment Available now
sa13064 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087782 Essential Splice Site 33 385 1 11
Genomic Location (Zv9):
Chromosome 6 (position 14881037)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14854269
GRCz11 6 14981209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCTGCGGGAAGAATTTCTGTTTGTCASGATCAAGGACAGCTTCACAG[G/T]TGAAATKCGTTCTTTTTGTTCCTYTGTTTAAGAGCAGTTTAAGTACYAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087782 Essential Splice Site 152 385 5 11
Genomic Location (Zv9):
Chromosome 6 (position 14904230)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14877462
GRCz11 6 15004402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAYTTTCTGTTCWACACAGGGAAGCAGTCMTACTATTCTCTTATGCATG[T/C]AAGTTCAWCCTTTAGTTTTCATGAAATSCTTATRTCAGGCAATGCTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087782 Essential Splice Site 181 385 6 11
Genomic Location (Zv9):
Chromosome 6 (position 14912620)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 14885852
GRCz11 6 15012792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGATAAGATGAGAAATAAAGGCCTCTTTATGGCAGACACAAAGCAAAT[G/A]TAAGCACCTGARAAGTAAAGAAACCTTTTTTGCACAGTGGTTCTCAANCCNT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link