zgc:153957

Ensembl ID:
ENSDARG00000061504
ZFIN ID:
ZDB-GENE-070209-38
Description:
hypothetical protein LOC570194 [Source:RefSeq peptide;Acc:NP_001077320]
Human Orthologue:
KDM4C
Human Description:
lysine (K)-specific demethylase 4C [Source:HGNC Symbol;Acc:17071]
Mouse Orthologue:
Kdm4c
Mouse Description:
lysine (K)-specific demethylase 4C Gene [Source:MGI Symbol;Acc:MGI:1924054]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39604 Nonsense Mutation detected in F1 DNA During 2018
sa19486 Nonsense Available for shipment Available now
sa12098 Nonsense Available for shipment Available now
sa24842 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Nonsense 116 1482 4 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20776277)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21248373
GRCz11 1 21941310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGTGTGCTCTACCTCCTCAGGTACTGTACACCGCGCTATCTGAACTA[T/A]GAAGACCTGGAGAGGAAGTATTGGAAGAATCTGACATTCGTCTCGCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Nonsense 330 1482 9 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20782191)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21254287
GRCz11 1 21947224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGGTGAAGATCTCCATGGATCCATTTGTTAGACGATTTCAGCCGGAT[C/T]GATACGAGATGTGGACGCAAGGCAAAGATTCATGCTCCCTGGATCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Nonsense 534 1482 11 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20785128)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21257224
GRCz11 1 21950161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAYGTGACTYTAGGCTCAGAAAGAACTGCTRAGAATCCTAATCAAACAT[T/A]AAACTGTGAATCTGTCTYAGAAAYCATTGCACCTTCTATTCCTGTGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087729 Nonsense 866 1482 11 22

The following transcripts of ENSDARG00000061504 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20786123)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21258219
GRCz11 1 21951156
KASP Assay ID:
554-7764.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCCATGATTCGTTACCGTACACCATGTGGTCAGAGTCAGGGTGCCAA[C/T]AAGAAAAGTTCTCAGATTCTCCAAACTCTTCACCTCACACCCAGACCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link