zgc:172281

Ensembl ID:
ENSDARG00000061498
ZFIN ID:
ZDB-GENE-080204-69
Description:
dual specificity protein phosphatase 13 [Source:RefSeq peptide;Acc:NP_001103865]
Human Orthologue:
DUSP13
Human Description:
dual specificity phosphatase 13 [Source:HGNC Symbol;Acc:19681]
Mouse Orthologue:
Dusp13
Mouse Description:
dual specificity phosphatase 13 Gene [Source:MGI Symbol;Acc:MGI:1351599]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10444 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087767 Essential Splice Site 43 188 3 4
ENSDART00000123866 Essential Splice Site 44 189 3 4
Genomic Location (Zv9):
Chromosome 13 (position 25071099)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24716759
GRCz11 13 24847209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGAATGAAAATGTACAGATMTACAGATGTTCTCMGTGTTTTTGTTTTCTC[A/C]GGGTTGCGGCGCGAGACAAGCCAATGCTGTATAATATGGGGATCACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link