Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:172281
- Ensembl ID:
- ENSDARG00000061498
- ZFIN ID:
- ZDB-GENE-080204-69
- Description:
- dual specificity protein phosphatase 13 [Source:RefSeq peptide;Acc:NP_001103865]
- Human Orthologue:
- DUSP13
- Human Description:
- dual specificity phosphatase 13 [Source:HGNC Symbol;Acc:19681]
- Mouse Orthologue:
- Dusp13
- Mouse Description:
- dual specificity phosphatase 13 Gene [Source:MGI Symbol;Acc:MGI:1351599]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa10444 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10444
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000087767 | Essential Splice Site | 43 | 188 | 3 | 4 |
| ENSDART00000123866 | Essential Splice Site | 44 | 189 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 13 (position 25071099)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 24716759 GRCz11 13 24847209 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- YGAATGAAAATGTACAGATMTACAGATGTTCTCMGTGTTTTTGTTTTCTC[A/C]GGGTTGCGGCGCGAGACAAGCCAATGCTGTATAATATGGGGATCACACAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
